Phospho hsp27

Rat's skeletal muscles of each group (n = 5; half muscle, 100–200 mg) at 2- and 5-day post-injury were lysed with the appropriate buffer plus a mixture of protease and phosphatase inhibitors (Sigma Aldrich). Homogenates were all centrifuged at 14,000 g for 15 min at 4°C. Equal amounts of muscle proteins (15–20 µg) were separated by SDS-PAGE and transferred onto PVDF membranes (Amersham Pharmacia Biotech). Membranes were incubated overnight with the following primary antibodies: MyoD1 (1: 2,000), SRF (1: 500), myogenin (1: 2,000), phospho-ERK1/2 (1: 1,000), Hsp27 (1: 2,000), Bax (1∶1,000) and Akt (Santa Cruz) (Santa Cruz Biotechnology); phospho-p38MAPK (1: 1,000), p38 (1: 1,000), caspase 3 (1: 1,000), phospho-NF-κB p65 (Ser536) (1: 1,000), Bcl-2 (1: 1,000), phospho-Akt (Ser473) (1: 1,000), phospho-Hsp27 (Ser82) (1: 1,000) and p42 MAP Kinase (1: 1,000) (ERK2) (Cell Signaling); Hsp70/72 (1∶1,000), αB-crystallin (1: 2,000) and S59 phospho-αB-crystallin (1: 2,000) (Enzo Life Science); GAPDH (1: 3,000) (Millipore). Blots were incubated with the appropriate horseradish peroxidase-conjugated secondary antibodies (1: 15,000) (Millipore), and proteins were visualized by chemiluminescence (EuroClone). Bands were quantified by Image J software. The expression of GAPDH was used as a normalizing control. Phosphorylated isoform was normalized on the amount of its total protein.

The following were purchased: antibodies, SEK1/MKK4 (#9152), phospho-p38 MAPK (T180/Y182) (#4631), p38 MAPK (#9212), phospho-SAPK/JNK (T183/Y185) (#4668), SAPK/JNK (#9258), phospho-HSP27 (#2401), HSP27 (#2402), and GAPDH (#2118), all from Cell Signaling Technology, and horseradish peroxidase-conjugated anti-mouse and anti-rabbit, from GE Healthcare Biosciences; plasmids, wild type and constitutive active MAP2K4 (#14615 and #14813; Addgene) and GFP (Vivid Colors pcDNA 6.2/N-EmGFP-GW/TOPO, Invitrogen); chemical inhibitors, p38 MAPK inhibitor, SB203580 (Sigma-Aldrich) and associated negative control, SB202474, and JNK Inhibitor II (SP600125), and JNK Inhibitor II Negative Control (N¹-Methyl-1,9-pyrazoloanthrone), all from EMD Millipore.

Recombinant human TGF-β1 (Cat# 240-B/CF) was obtained from R&D Systems (Minneapolis, MN); recombinant human TNFα (Cat# CYT-223) was from ProSpec-Tany TechnoGene Ltd (Rehovot, Isreal). Antibodies for: GAPDH (Cat# sc-25778), p38MAPK(sc-81621) and IκBα (Cat# sc-371) were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA); phospho-Smad2 (Cat# 3108), phospho-HSP27 (Cat# 2401), phospho-p38 (Cat# 9211), RELA/p65 (Cat# 8242) and ICAM1 (Cat# 4915) were from Cell Signaling Technology (Danvers, MA); α-Tubulin (Cat# T6074), α-Catenin (Cat# C2081) and FLAG (Cat# F3165) were from Sigma-Aldrich (St. Louis, MO); FN1 (Cat# 610077) and Smad2 (Cat# 610842) were from BD Biosciences (San Jose, CA). Goat anti-Rabbit IgG (H+L)-Horseradish Peroxidase (HRP) (Cat# 170-6515) and goat anti-Mouse IgG (H+L)-HRP (CAT# 170-6516) secondary antibodies were from BIO-RAD Laboratories (Hercules, CA). Inhibitor of p38, SB202190 (Cat# 559388) was obtained from Calbiochem (EMD Millipore; Billerica, MA). Retroviral constructs encoding EGFP, FLAG-p38MAPK-AGF and HA-MKK6-AL are described in [24 (link)]. Short interfering RNA (siRNA) to human p38-alpha (MAPK14; Cat # 1299001; VHS40416; sequence CCAAAUUCUCCGAGGUCUAAAGUAU) was from Thermo Fisher Scientific (Waltham, MA).

Cells were lysed in 10 mM HEPES, pH 7.9, 350 mM NaCl, 1 mM MgCl₂, 0.5 mM EDTA, 0.1 mM EGTA, 1% Nonidet P-40, 20% glycerol, 5 mM dithiotreitol, 2.5 mM phenylmethylsulfonyl fluoride, and 20 mg/ml aprotenin. Equal amounts of protein were resolved by SDS-PAGE, electrotransferred to polyvinylidene difluoride membranes (EMD Millipore, Billerica, MA) and probed with antibodies directed against p38 MAPK, phospho-p38 MAPK, phospho-HSP27(Ser82), p21 Waf1/CIP1, eEF2, phospho-eEF2(Thr56), phospho-AMPKα (Thr172) ULK1, phospho-ULK1(Ser555), LC3B, beclin-1, caspase-1, caspase-3, cleaved caspase-3, PARP, and α-tubulin according to the specifications of the manufacturer (Cell Signaling Technology, Danvers, MA). The antibody detecting GAP-DH was from EMD Millipore, the antibody detecting RhoA was from Santa Cruz Biotechnology (Santa Cruz Biotechnology, Santa Cruz, CA). Specific protein bands were visualized using horseradish-peroxidase conjugated anti-rabbit IgGs and enhanced chemiluminescence reagents (GE Healthcare, München, Germany).

Cell lysates were separated with SDS-PAGE as described previously.²⁸ Proteins were detected using specific primary antibodies against p38 MAPK (#9212), phospho-p38 MAPK (Thr180/Tyr182; #9215), MK2 (#3042), Hsp27 (#2402), phospho-Hsp27 (Ser82; #2401), Cdk1 (#9116), phospho-Cdk1 (Tyr15; #9111), phospho-Histone H3 (Ser28; #9713), cyclin B1 (#4135), Cdc25c (#4688), phospho-Cdc25c (Ser216; #4901), PARP (#95425), Bcl-2 (#2870), phospho-Bcl-2 (Ser70; #2870), Bcl-X_L (#2764), and Mcl-1 (#5453, all from Cell Signaling Technology, Danvers, MA, USA). Antibodies against phospho-MK2 (Thr334; #ab51018) and β-tubulin (#ab11308) were from Abcam (Cambridge, UK). Antibodies against β-actin (#A5316) and GAPDH (#737179) were from Sigma-Aldrich and Santa Cruz Biotechnology, respectively. Secondary antibodies were from Cell Signaling Technology. Detection was performed using the Immobilion Western HRP Substrate Luminol-Peroxidase reagent (MerckMillipore, Billerica, MA, USA) and the ChemiDoc MP System (Bio-Rad, Hercules, CA, USA). Band intensities were quantified by Image-Lab (Bio-Rad).

Collagen (type I, equine tendon) was obtained from Chrono-Log Corporation. (Broomall, PA, USA). RIPA buffer was obtained from Pierce Biotechnology Inc (Meridian Rd, Rockford, USA). The enzyme-linked immunosorbent assay (ELISA) kit of cyclic GMP, and PPAR-γ antibody were purchased from Cayman Chemical Company (Ann Arbor, MI, USA). The GSK0660 and GW9662 were purchased from Tocris (Avonmouth, Bristol, UK). ECL reagent was purchased from Upstate Biotechnology (Lake Placid, NY, USA). The antibodies of PPAR-β, and β-actin were purchased from Senta cruz biotechnology (Santa Cruz, CA, Europe). The phospho-HSP27, total-HSP27, phospho-p38 mitogen-activated protein kinase (p38MAPK), total-p38MAPK, phospho-ERK1/2, total-ERK1/2 antibodies were purchased from Cell Signaling Technology (Beverly, MA, USA). Nifedipine was purchased from Sigma Chemical Company (St. Louis, MO, USA) and dissolved in dimethylsulfoxide (DMSO) followed by dilution with Tyrode solution, and the final concentration of DMSO was fixed at 0.1%. Other chemical reagents were purchased from Sigma Chemical Company.