Mir 195 5p mimic

miR-195-5p mimic, mimic control, miR-195-5p inhibitor and inhibitor control were purchased from RIBOBIO (Guangzhou, China). GenePharma (Shanghai, China) was the provider of specific LINC01547 small interfering (si)RNAs (si-LINC01547) and negative control siRNA (si-NC). The siRNA sequences are presented in Table 1. HOXC8 was overexpressed in NSCLC cells by transfecting with pcDNA3.1-HOXC8 (pc-HOXC8) plasmid (Sangon; Shanghai, China). All transfection experiments were carried out using Lipofectamine® 3000 (Invitrogen, CA, USA).Table 1

The sequences of siRNAs.

Table 1

siRNA	Sequence (5′-3′)
si-LINC01547#1	TGGCCTTTTTAAAATTCTATATT
si-LINC01547#2	GGCCTTTTTAAAATTCTATATTT
si-LINC01547#3	GCCTTTTTAAAATTCTATATTTG
si-NC	CACGATAAGACAATGTATTT

miR-195-5p mimic and the negative control miRNA (miRNA-NC) were obtained from Guangzhou RiboBio Co., Ltd. The E2F3 overexpression vector pcDNA-E2F3 and empty control vector pcDNA-NC were constructed by Shanghai GenePharma Co., Ltd. The sequences were as follows: miR-195-5p mimic sense, 5'-UAGCAGCACAGAAAUAUUGGC-3'; miR-195-5p mimic antisense, 5'-CAAUAUUUCUGUGCUGCUAUU-3'; mimics negative control (miR-NC) sense, 5'-UUCUCCGAACGUGUCACGUTT-3'; miR-NC antisense, 5'-ACGUGACACGUUCGGAGAATT-3'. Cells were plated into 6-well plates (1x10⁶ cells per well), and transfection was performed when cells at the logarithmic growth phase reached 80% confluence. According to the product instructions, AMC-HN-8 cells were transfected with miR-195-5p mimic (50 nM), miR-NC (50 nM), pcDNA-E2F3 (100 nM) and pcDNA-NC (100 nM) using Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). The transfection efficiencies were assessed by RT-qPCR at 48 h after transfection.

Inhibitor control (chemically modified RNA single strand), miR-195-5p inhibitor (chemically modified RNA single strand), mimic control and miR-195-5p mimic were purchased from Guangzhou RiboBio Co., Ltd. HUVECs were plated into 6-well plates at a density of 1×10⁶ cells/well and cultured at 37°C with 5% CO₂ for 24 h. Then, 100 nM miR-195-5p inhibitor (5′-GCCAAUAUUUCUGUGCUGCUA-3′), 100 nM Inhibitor control (5′-CAGUACUUUUGUGUAGUACAA-3′), 50 nM miR-195-5p mimic (5′-UAGCAGCACAGAAAUAUUGGC-3′), 50 nM mimic control (5′-UUCUCCGAACGUGUCACGUTT-3′), 1 µg Bcl-2 CRISPR Activation Plasmid (Bcl-2 plasmid; cat no. sc400025-ACT; Santa Cruz Biotechnology, Inc.), 1 µg control CRISPR Activation Plasmid (control plasmid; cat no. sc-437275; Santa Cruz Biotechnology, Inc.), or 50 nM miR-195-5p mimic + 1 µg Bcl-2 plasmid was transfected into HUVECs by using Lipofectamine 2000, according to the manufacturer's protocols. A total of 48 h after cell transfection, reverse transcription-quantitative PCR (RT-qPCR) was performed to assess the transfection efficiency.