Hiseq 4000 sequencing kit

Isolation of RNA from tissue was performed using RNeasy Mini Kit (Qiagen, Gaithersburg, MD, USA), per manufacturer’s instructions. After extraction, RNA was analyzed by NanoDrop® (Thermo Fisher Scientific) and Bioanalyzer® (Agilent, Santa Clara, CA, USA) to evaluate concentration, purity and integrity. All samples had a 230/260 ratio > 1.8, a 260/280 ratio > 2.0 and an RNA integrity number > 8.0.
Library preparation was performed using the TruSeq Stranded mRNA Sample Prep Kit (Illumina), per manufacturer’s instructions. The adapter for Read 1 was AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG, with NNNNNN signifying the index sequence. The read 2 adapter was AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCAT. All reads were quantified with qPCR. Sequencing was performed on a HiSeq 4000 (Illumina) using a HiSeq 4000 sequencing kit version 1, generating 150 bp paired-end reads (University of Illinois Roy J. Carver Biotechnology Center). FASTQ files were generated and demultiplexed using bcl2fastq v2.17.1.14 Conversion Software (Illumina). All sequencing data have been deposited in NCBI Sequence Read Archive via the Gene Expression Omnibus and are available through GEO Series accession numbers GSE136691 and GSE108279.

Next-generation sequencing and data processing of A20 cancer cell line were performed as previously described^{70 (link)}. In brief, total DNA and RNA were purified from triplicates of cultured A20 lymphoma cell line using DNeasy Blood and Tissue Kit (QIAGEN) and RNAeasy Mini Kit (QIAGEN). Exome capture was performed using the SureSelectXT mouse exon kit (Agilent). Exome capture libraries were then paired-ended sequenced on a HiSeq 4000 (Illumina) using the HiSeq 4000 sequencing Kit (200 cycles). 50 M exome reads were sequenced from each sample. 500 ng of total RNA per sample was used to generate barcoded mRNA-seq cDNA libraries using TruSeq V2 kit (Illumina). All libraries were sequenced on an Illumina HiSeq4000. 30 M reads were sequenced from each sample.

All Lazaro and enriched barcode samples were dried in a speed vacuum centrifuge. For the feeding bioassay samples, 20 samples were dried, which comprised 5 treatments (without feeding and 4 times after feeding) × 2 sexes × 2 methods (metabarcoding and Lazaro). For the field samples, 54 samples were dried, which comprised 27 for metabarcoding and 27 for Lazaro. The dried feeding bioassay and field samples were shipped simultaneously to the Roy J. Carver Biotechnology Center (University of Illinois at Urbana-Champaign, IL, USA) to construct KAPA Hyper libraries (Kapa Biosystems, Wilmington, MA, USA) with insert size 200–600 bp using unique dual indexes. Quality-checked samples were sequenced by Illumina HiSeq4000 (Illumina HiSeq 3000/HiSeq 4000 System, RRID:SCR_016386) (150 bp paired-end, 151 cycles, HiSeq 4000 sequencing kit version 1) in a single lane. The Brazilian license to access the genetic heritage was provided by CGEN/SISGEN A8E3D94. Sequence SRA access codes are presented in Supporting Information 1.