Log In Sign up
The largest database of trusted experimental protocols

Sigma mission lentiviral packaging mix

Manufactured by Merck Group
Visit Supplier

Sigma Mission Lentiviral Packaging Mix is a collection of plasmids designed for the production of lentiviral particles. The mix contains the necessary genetic elements required for the packaging and assembly of lentiviral particles in mammalian cells.

Automatically generated - may contain errors

Lab products found in correlation

Fugene 6 transfection reagent, by Promega (2 mentions) Puromycin, by Thermo Fisher Scientific (2 mentions) Shc002, by Merck Group (1 mentions) Hek293t cell, by American Type Culture Collection (1 mentions) Polybrene, by Merck Group (1 mentions)

Spelling variants of this product

MISSION Lentiviral Packaging Mix (80 citations) Lentiviral packaging mix (29 citations) Sigma Mission (3 citations)

5 protocols using sigma mission lentiviral packaging mix

1

Lentiviral shRNA knockdown of PPP2CA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Scramble shRNA SHC002 was purchased from Sigma (St. Louis, MO). Sequences used for gene knockdown were shPPP2CA: (1) CCGGTGGAACTTGACGATACTCTAACTCGAGTTAGAGTATCGTCAAGTTCCATTT TG (2) CCGGCCCATGTTGTTCTTTGTTATTCTCGAGAATAACAAAGAACAACATGGG TTTTTG. Oligonucleotides were annealed and cloned into pLKO.1. Lentivirus was prepared using Sigma MISSION lentiviral packaging mix (SHP001) together with shRNA and transfected into 293T cells. Virus supernatants were harvested 48 hr after transfection, filtered with a 0.45 μm filter; and together with polybrene, used to infect pancreatic cancer cells. Stable knockdown cells were selected with puromycin.
Chien W., Sun Q.Y., Lee K.L., Ding L.W., Wuensche P., Torres-Fernandez L.A., Tan S.Z., Tokatly I., Zaiden N., Poellinger L., Mori S., Yang H., Tyner J.W, & Koeffler H.P. (2015). Activation of protein phosphatase 2A tumor suppressor as potential treatment of pancreatic cancer. Molecular Oncology, 9(4), 889-905.
+ Open protocol
+ Expand
2

Knockdown and Overexpression of CEBPB

Check if the same lab product or an alternative is used in the 5 most similar protocols
Five CEBPB MISSION shRNA Plasmid DNA (Sigma) clones were used in knockdown experiments (TRCN0000007440, TRCN0000007441, TRCN0000007442, TRCN0000007443, TRCN0000007444). shRNA lentivirus was packaged in HEK293 cells using Sigma Mission Lentiviral Packaging mix. For overexpression, MSCV constructs containing CEBPB were packaged into retroviruses by co-transfection with packaging plasmids in 293-EBNA (Life Technologies) cells.
Gardiner J.D., Abegglen L.M., Huang X., Carter B.E., Schackmann E.A., Stucki M., Paxton C.N., Randall R.L., Amatruda J.F., Putnam A.R., Kovar H., Lessnick S.L, & Schiffman J.D. (2017). C/EBPβ-1 promotes transformation and chemoresistance in Ewing sarcoma cells. Oncotarget, 8(16), 26013-26026.
+ Open protocol
+ Expand
3

Generation of Stable SORT1-Expressing Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
300-19 cell lines stably expressing human or mouse SORT1 were generated as previously described (Wang et al., 2018 (link)). In order to produce lentiviral particles, HEK293T cells (ATCC) were transiently transfected with pLenti6.2C-V5-DEST vector containing the full-length human mouse SORT1 gene together with Sigma Mission Lentiviral Packaging Mix (Sigma-Aldrich) by using Fugene 6 transfection reagent (Promega) according to the manufacturer’s protocol. Culture medium containing virus was collected 48 h post transfection and precleaned by centrifugation at 2,000 g and filtration using a 0.45 μm filter unit (PALL Life Sciences). 300-19 cells were transduced with the viral supernatant and then selected with culture medium containing 1.5 or 9 μg/mL puromycin (Thermo Fisher Scientific) for human or mouse SORT1, respectively. puromycin-resistant cells were maintained in the puromycin-containing selection medium for 10 days and subcloned by a limiting dilution. Outgrown cells were evaluated by FCM for the expression of human or mouse SORT1.
Miyakawa S., Sakuma H., Warude D., Asanuma S., Arimura N., Yoshihara T., Tavares D., Hata A., Ida K., Hori Y., Okuzono Y., Yamamoto S., Iida K., Shimizu H., Kondo S, & Sato S. (2020). Anti-sortilin1 Antibody Up-Regulates Progranulin via Sortilin1 Down-Regulation. Frontiers in Neuroscience, 14, 586107.
+ Open protocol
+ Expand
4

Alveolar Macrophage Isolation and Culture

Check if the same lab product or an alternative is used in the 5 most similar protocols
The murine alveolar macrophage cell line (MH-S, ATCC CRL-2019, originating from male BALB/c mouse) was cultured in RPMI medium in 10% FBS supplemented with 10 μM β-mercaptoethanol at 37 °C and 5% CO2. Cell culture and generation of MHS cells with stable knockdown of Orai1, Stim1 or a scrambled shRNA control were performed using the Sigma mission lentiviral packaging mix (Sigma-Aldrich) with the following catalog numbers: ORAI1 (TRCN0000125405), STIM1 (TRCN0000193400), non-target control (SHC312). Transformed cells were cultured with 10 μg/ml puromycin for 2 passages and reduction in the expression of the target gene was assessed using western blot or RT-PCR.
Mouse primary alveolar macrophages were isolated by bronchoalveolar lavage performed in euthanized mice with 3 ml of PBS with 1 mM EDTA. Only male mice were used as a source of alveolar macrophages. The lavage was centrifuged at 300 g for 10 minutes and resuspended in RPMI supplemented with 10% FBS and plated in a density of 100,000 cells/cm2. Cell purity was analyzed by flow cytometry and was confirmed to be >95%.
Soberanes S., Misharin A.V., Jairaman A., Morales-Nebreda L., McQuattie-Pimentel A.C., Cho T., Hamanaka R.B., Meliton A.Y., Walter J.M., Chen C.I., Chi M., Chiu S., Gonzalez-Gonzalez F.J., Antalek M., Adbala-Valencia H., Chiarella S.E., Sun K.A., Woods P.S., Ghio A.J., Jain M., Perlman H., Ridge K.M., Morimoto R.I., Sznajder J.I., Balch W.E., Bhorade S.M., Bharat A., Prakriya M., Chandel N.S., Mutlu G.M, & Budinger G.S. (2018). Metformin Targets Mitochondrial Electron Transport to Reduce Air Pollution-Induced Thrombosis. Cell metabolism, 29(2), 335-347.e5.
+ Open protocol
+ Expand
5

Lentiviral Transduction of Murine Pre-B Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T cell line (ATCC, cat. CRL-11268) was grown in DMEM medium supplemented with 10% FBS at 37 °C and 5% CO 2 . Murine pre-B lymphocyte cell line, 300-19 (purchased from Dr. Naomi Rosenberg's Lab, Tufts University), was grown in RPMI 1640 medium supplemented with 10% FBS, and 50 µM 2-ME (Thermo Fisher, cat. 21985-023). Lentiviruses were produced by transfecting HEK293T cells with pLenti6.2C-V5-DEST vector containing the fulllength gene of interest together with Sigma Mission Lentiviral Packaging Mix (Sigma-Aldrich, cat. Sigma SHP001-1.7ML) by using a Fugene 6 transfection reagent (Promega, cat. E269A) according to the manufacturer's protocol. Sixteen hours posttransfection, the culture medium was replaced with fresh growth medium. The culture medium containing virus was collected 48 h after transfection and then precleaned with a 2000g centrifuge and a 0.45 µm filter unit (PALL Life Sciences PN, cat. 4614). 300-19 cells cultured in the growth medium were transduced with the viral packaging supernatant in the presence of 2 µg/mL polybrene (Sigma-Aldrich, cat. 107689-10G). The culture medium was replaced with fresh growth medium containing 1.5 µg/mL puromycin (Thermo Fisher, cat. A11138-03) 3 days after incubation. puromycinresistant pooled cells were maintained in the selection medium for 10 days and evaluated by FACS analysis.
Wang Y., Yoshihara T., King S., Le T., Leroy P., Zhao X., Chan C.K., Yan Z.H, & Menon S. (2018). Automated High-Throughput Flow Cytometry for High-Content Screening in Antibody Development. SLAS discovery : advancing life sciences R & D, 23(7).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!