2xhifi dna assembly master mix

The deletion of mprF gene in S. aureus USA300∆lpl∆spa::erm was generated by homologous recombination. First, pBASE‐mprF knockout plasmid containing the upstream and downstream flanking region was constructed. The 1000 bp upstream fraction was amplified by PCR using primer pairs F_up (5’‐GGAATT CCGGAGCTCGGTACTCTACTTGAAAAAATGAGTGTTC‐3’) and R_up (5’‐TTAATTATTTGTGCTGATTCATTTTTTCACATCAATTC‐3’) and the 741 bp downstream using F_down (5’‐AATGAATCAGCACAAATAATTAAAATCCAAGTGC‐3’) and R_down (5’‐CGACAGATCTGCGCGCTAGCTACTAAGGTCTAATGAAAGGATG‐3’). These two fragments were ligated into linearized pBASE by Gibson Assembly method. Briefly, the mixture of purified PCR flanking fragments and linearized plasmid were mixed 2xHiFi DNA Assembly Master Mix (New England Biolabs Inc., UK) at ratio 1:1 and incubated at 50°C for 1 hr. Later the ligation mixture was transformed into chemo‐competent E. coli DC10B and plated onto BM Ampicillin (100 μg/ml) plate and incubated at 37°C. The clones containing plasmid pBASE‐mprF were screened using colony PCR and confirmed by DNA sequencing. The correct plasmid pBASE‐mprF subsequently transformed by electroporation into USA300∆lpl∆spa::erm. The deletion procedure of mprF gene was followed as described previously (Bae & Schneewind, 2006). The final gene deletion was checked and confirmed by PCR and DNA sequencing.

Escherichia coli strain DLF_Z0025 was constructed as previously reported (Li et al., 2020 (link); Menacho-Melgar et al., 2020b ). The GRFT sequence as reported by Mori et al. (Mori et al., 2005 (link)) was codon-optimized and incorporated in a synthetic DNA construct (IDT, Coralville, IA) under the control of the low phosphate inducible phoA, phoB, and yibD gene promoters (Moreb et al., 2020 (link)). These genes were inserted into the pSMART-HC-Kan vector (Lucigen, Middleton, WI) using 2X HiFi DNA Assembly Master Mix from New England Biolabs (Ipswich, MA) according to manufacturer instructions. The resulting plasmids were pHCKan-phoAp-GRFT (Addgene #158747), pHCKan-yibDp-GRFT (Addgene # 158745), pHCKan-phoBp-GRFT (Addgene # 158746). Additionally, a plasmid to express Q-GRFT [an enhanced variant of GRFT (Günaydın et al., 2019 )], was cloned using around the world Q5 mutagenesis (New England Biolabs, Ipswich, MA) following manufacturers instruction, pHCKan-yibDp-GRFT as a template and primers Q-GRFT_F and Q-GRFT_R (GGCCCATACGGAGGGTCG and GAAACGACGCCCCTGATTCGTCTC, respectively). The resulting plasmid was pHCKan-yibDp-Q-GRFT (Addgene # 158748). All plasmids were confirmed via Sanger sequencing at Genewiz, Research Triangle Park, NC.