(S)–(-)-Nicotine (>99%) was obtained from Chemsky international Co., Ltd (Shanghai, China). 6 HN was a gift from Jiguo Qiu (Nanjing Agricultural University, China). TransStart® FastPfu DNA Polymerase for fragment amplification was purchased from TransGen Biotech (Beijing, China). Restriction enzymes used for plasmid construction and a premixed protein marker for protein electrophoresis were purchased from Takara Biotechnology Co., Ltd. (Dalian, China). Antibiotics, isopropyl β-D-1-thiogalactopyranoside (IPTG) and other reagents were purchased from Shanghai Sangon Biotech Co., Ltd. (Shanghai, China). A plasmid extraction kit, gel extraction kit and DNA purification kit were obtained from Omega Bio-tek, Inc (Norcross, GA, USA).
Plasmid extraction kit
Manufactured by Omega Bio-Tek
Sourced in United States
The Plasmid Extraction Kit is a laboratory tool designed for the isolation and purification of plasmid DNA from bacterial cultures. It provides a reliable and efficient method for extracting plasmids, which are crucial components in various molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
Gel extraction kit, by Omega Bio-Tek (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Dna purification kit, by Omega Bio-Tek (1 mentions)
Isopropyl β d 1 thiogalactopyranoside (iptg), by Sangon (1 mentions)
Transstart fastpfu dna polymerase for fragment amplification, by Transgene (1 mentions)
Ix51 inverted fluorescence microscope, by Olympus (1 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Hec 1a cells, by Wuhan Servicebio Technology (1 mentions)
Dipalmitoylphosphatidylcholine dppc, by Lipoid (1 mentions)
T4 ligase, by Takara Bio (1 mentions)
Dna restriction enzyme, by Takara Bio (1 mentions)
Dntps, by Takara Bio (1 mentions)
Transstart fastpfu dna polymerase, by Transgene (1 mentions)
Dl5000 marker, by Takara Bio (1 mentions)
Reverse transcription kit, by Vazyme (1 mentions)
Phanta high fidelity dna polymerase, by Vazyme (1 mentions)
Quickcut restriction enzymes, by Takara Bio (1 mentions)
Pcr purification kit, by Omega Bio-Tek (1 mentions)
Xhoi, by Takara Bio (1 mentions)
Dna extraction kit, by Omega Bio-Tek (1 mentions)
11 protocols using plasmid extraction kit
1
Nicotine Synthesis and Plasmid Construction
2
CRISPR/Cas9 Transfection in HEC-1A Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEC-1A cells were obtained from Servicebio (Wuhan, China). The CRISPR/Cas9 plasmid was purchased from GenePharma (Shanghai, China). The plasmid extraction kit and reverse transcription (RT)-PCR kit were obtained from Omega Bio-tek (Norcross, GA, USA). High-glucose Dulbecco’s modified Eagle’s medium (DMEM) with serum phosphate-buffered saline (PBS) and fetal bovine serum (FBS) were purchased from HyClone (Jülich, Germany). Dipalmitoylphosphatidylethanolamine (DPPE) and dipalmitoylphosphatidylcholine (DPPC) were obtained from Lipoid (Steinhausen, Switzerland). DC-cholesterol (3ß-[N-(N′, N′-dimethylaminoethane)-carbamoyl]cholesterol) was purchased from Avanti Polar Lipids (Alabaster, AL, USA). The IX51 inverted fluorescence microscope was obtained from Olympus (Tokyo, Japan). The GCZZ ultrasound transfection system was developed by Chongqing Medical University (Chongqing, China). The 7500 Real-Time PCR System was from Applied Biosystems (Foster City, CA, USA).
3
DNA Polymerase Enzymatic Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In this study, the TransStartFastPfu DNA polymerase and TransStartR easyTaq DNA polymerase were purchased from TransGen Biotech Co., Ltd. (Beijing, China). DNA restriction enzymes, T4 ligase, dNTPs, RNase, and DL5000 Marker were provided by Takara Biotechnology Co., Ltd. (Dalian, China). The DNA recovery kit and plasmid extraction kit were bought from Omega Bio-Tek, Guangzhou, China. Other chemicals were bought from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China).
4
Molecular Cloning and Expression Tools
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA electrophoresis, Gibson assembly reaction, DNA enzyme digestion and ligation, and plasmids transformation were performed in accordance with the standard laboratory protocols. Phanta high-fidelity DNA polymerase (Vazyme, Biotech Co., Ltd., China) was used in PCRs (Polymerase Chain Reaction). Plasmid extraction kit, gel extraction kit and total bacterial RNA extraction kit were purchased from Omega Bio-tek (Norcross, GA, United States). Gibson assembly reaction kits were purchased from Clonesmarter Technologies (Scottsdale, AZ, United States). QuickCut restriction enzymes were purchased from Takara (Dalian, China). The reverse transcription kit and qRT-PCR master mix were purchased from Vazyme (China).
5
Plasmid Extraction for CRISPR/Cas9
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A 1 ml LB culture containing the CRISPR/Cas9 plasmid was agitated overnight at 37°C. The plasmid was then extracted using a plasmid extraction kit according to the manufacturer’s instructions (Omega Biotek). The extracted plasmid (>1.0 μg/μL) was used for the next step.
6
Bacillus subtilis 1AJ3 Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacillus subtilis 1AJ3 (GenBank No. MG062801) was isolated from rotten wood in Qinling mountains (Ma et al., 2020c (link)). The bacteria were grown in LB medium (NaCl 10 g/L, tryptone 10 g/L, yeast extract powder 5 g/L), single carbon source medium of switchgrass (7%), and ionic liquids of (NH4)2SO4 2.0 g/L, MgSO47H2O 0.5 g/L, and K2HPO4 1.0 g/L at pH of 7.2 or 5.6. The medium was sterilized at 121°C for 20 min before use.
Plasmid pET-28a was used to construct a recombinant expression vector. E. coli BL21(DE3) was used as the expression host. Restriction endonucleases NcoI and XhoI were purchased from Takara. DNA Extraction Kit, Plasmid Extraction Kit, and PCR Purification Kit were purchased from Omega Bio-Tek, Inc. Primer synthesis and sequencing were entrusted to Sangon Biotech Inc. (Shanghai).
Plasmid pET-28a was used to construct a recombinant expression vector. E. coli BL21(DE3) was used as the expression host. Restriction endonucleases NcoI and XhoI were purchased from Takara. DNA Extraction Kit, Plasmid Extraction Kit, and PCR Purification Kit were purchased from Omega Bio-Tek, Inc. Primer synthesis and sequencing were entrusted to Sangon Biotech Inc. (Shanghai).
7
Recombinant Alginate Lyase Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The recombinant plasmid harboring the alginate lyase gene, named DH5α-HTa-cAlyM, was transformed in E. coli DH5α and preserved in our lab. The expression system was E. coli BL21 (DE3) cell and pProEX HTa plasmid, which were preserved in our lab. Luria–Bertani (LB) medium comprised of 10 g/L NaCl, 10 g/L tryptone and 5 g/L yeast extract (100 µg/mL ampicillin was added before use). High-fidelity DNA polymerase was purchased from Vazyme Biotech Co., Ltd. (Nanjing, China). The plasmid extraction kit was purchased from Omega Bio-tek, Inc. (Norcross, GA, USA). DpnI, a restriction enzyme, was purchased from Thermo Fisher Scientific (Waltham, MA, USA).
8
Primers for Detecting Feline Viral Pathogens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FCV (GenBank: MW804434.1), FPV (GenBank: MZ836373.1) and FHV-1 (GenBank: MT813047) were identified for the reference strain, after aligning the genomes of FCV, FPV, and FHV-1 isolates in publicly available sequence data. Oligo7.0 Primer Analysis software (Molecular Biology Insights, Inc. USA) was used to design primers for the conserved region fragments, and the predicted fragment lengths are 389 bp, 768 bp, and 513 bp. The designed primers are shown in Table 4 . The obtained fragment was ligated into pMD-19 T simple (Takara, 3271) as a standard recombinant plasmid and expanded using Trans1-T1 competent cells (TransGen Biotech, CD501). Recombinant plasmids were purified using a plasmid extraction kit (Omega Biotek, D6943), and finally sent to a biological company for sequencing.
Primers for Amplification of FCV, FPV, FHV-1 by conventional PCR and NanoRCR
| Primer name | Sequence (5′ - 3′) | Product (bp) |
|---|---|---|
| FCV-F | CAACCTGCGCTAACGTGCTTA | 389 |
| FCV-R | TGCAGTAATGGATCCATCATCCG | |
| FPV-F | CTTTGCCTCAATCTGAAGGAG | 768 |
| FPV-R | GAATTGGATTCCAAGTATGAG | |
| FHV-1-F | AGATTTGCCGCACCATACCTTC | 513 |
| FHV-1-R | CCGGGCTTTGAAAACACTGAAT |
9
Plasmid Extraction and Cell Transfection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Plasmid Extraction Kit (D6950-02, Omega Bio-Tek, Norcross, GA, USA), RNAi-Mate Transfection Reagent (Gima Genetics, China, G04001), phosphate buffer saline (PBS) (Solarbio, China, P1010), sodium pentobarbital (P3761, Sigma Merck, Germany), eosin (E8090, Solarbio, China), hematoxylin (G1004, Servicebio, China), neutral resin (G8590, Solarbio, China), nisin staining solution (G1036, Servicebio, China), TRIzol (15596026, Ambion, USA), SYBR FAST quantitative polymerase chain reaction Master Mix (KM4101, KAPA Biosystems, China), Oligo (dT) 18 Primer (3806, TAKARA, Japan), PrimeScript II Rtase (TAKARA, Japan, 2690A), Recombinant Rnase Inhibitor (TAKARA, Japan, 2313A), 10 mM dNTP Mix (PC2200, Solarbio, China), In Situ Cell Death Detection Kit (11684817910, ROCHE, Switzerland), DAB Concentrated Kit (DA1010-2 × 3 ml, Solarbio, China), Opti-MEM (31985-062, Gibco), Lipofectamine 2000 (11668-027, Invitrogen, USA), Dual luciferase reporter gene assay kit (RG027, Biyuntian, China), caspase-9 (PAB40626, Bioswamp, China), caspase-3 (PAB30047, Bioswamp, China), BCL2-Associated X (Bax) (PAB46088, Bioswamp, China), B-cell lymphoma-2 (Bcl-2)(PAB30041, Bioswamp, China), glyceraldehyde-3phosphate dehydrogenase (GAPDH) (PAB36269, Bioswamp, China), and Goat anti-Rabbit IgG (SAB43714, Bioswamp, China) were employed in this study. A flowchart of this study is shown in Figure 1 .
10
Characterization of L. fermentum RC4 Strain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
L. fermentum RC4 was preserved at the China General Microbiological Culture Collection Center (CGMCC NO. 8212). De Man, Rogosa and Sharpe (MRS) agar and broth medium were purchased from Qingdao Hope Bio-Technology Co., Ltd. (Shandong, China), and the Luria-Bertani (LB) medium was purchased from Fuyuan Biotch Co., Ltd. (Shanghai, China). The pET-28a-EGFP plasmid was purchased from Fenghui Biotech Co. Ltd (Hunan, China), and the Stbl3 E. coli competent cells were purchased from TransGen Biotech Co., Ltd. (Beijing, China). Polyethylene glycol (PEG) 20000 was purchased from Solarbio Technology Co., Ltd. (Beijing, China). The genomic DNA extraction kit, plasmid extraction kit, gel recycling kit, and reverse transcription PCR kit were obtained from Omega Bio-tek, Ink. (Georgia, USA). TemplatePrepKit 1.0 kit was obtained from KAPA Biosystems (Massachusetts, USA). ClonExpress II One Step Cloning Kit, and Ribo-off rRNA Depletion kit were obtained from Nanjing Vazyme Biotech Co., Ltd. (Jiangsu, China). HiPure Bacterial RNA Kit was obtained from Magen Biotech Co., Ltd. (Shanghai, China). The nitrite reductase activity assay kit was purchased from Suzhou Comin Biotech Co., Ltd. (Jiangsu, China). The nitrite detection kit was purchased from Nanjing Jiancheng Technology Co., Ltd. (Jiangsu, China). Other reagents are analytical grade.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!