Ion pgm hi q view ot2 kit

DNA was extracted using FastDNA SPIN Kit for Soil (MP Biomedicals, USA). Polymerase chain reaction (PCR) of 16S rRNA V3-4 region was performed employing Probio_Uni_F and Probio_Uni_R [26] (link) primers tagged with 10-11bp unique barcode labels along with the adapter sequence. PCR reaction was carried out using Phusion Hot Start II DNA Polymerase (Thermo Fisher Scientific, USA) and GeneAmp® PCR System 9700 (Thermo Fisher Scientific, USA) according to manufacturers' guidelines. Thermal conditions of the PCR reaction were set as follows: 98 °C for 30 seconds, 35 cycles of 98 °C for 10 seconds, 67 °C for 15 seconds, 72 °C for 15 seconds with a final extension at 72 °C for 7 minutes. PCR products were purified using NucleoMag® NGS Clean-Up and Size Select Kit (Macherey-Nagel, Germany). The quality and quantity of amplicons were assessed using Agilent High Sensitivity DNA kit and Agilent 2100 BioAnalyzer (Agilent Technologies, USA). Samples were diluted to 12 pM and pooled. Samples were sequenced on Ion Torrent Personal Genome Machine sequencing platform employing Ion PGM™ Hi-Q™ View OT2 kit (Life Technologies, USA) for template generation and Ion PGM™ Hi-Q™ View Sequencing kit (Life Technologies, USA) on Ion 318 v2 chip (Life Technologies, USA).

The amplification of the bacterial variable V4-V5 region of 16S rRNA was performed according to Fliegerova et al. [24 (link)] using EliZyme HS Robust MIX Red (Elisabeth Pharmacon) and 10 μM of each primer (forward: GGATTAGATACCCTGGTAGT, reverse: CACGACACGAGCTGACG). The thermal cycling conditions included initial denaturation for 10 min at 95 °C followed by 30 cycles of 30 s at 95 °C, 30 s at 57 °C, and 30 s at 72 °C. PCR amplicons (≈300 bp) were purified and libraries were prepared using the NEBNext Fast DNA Library Prep Set for Ion Torrent (New England BioLabs) and Ion Xpress Barcode Adapters 1–96 Kit (ThermoFisher Scientific). Libraries were consequently pooled, with their equimolar concentration determined with a KAPA Library Quantification Kit (KAPA Biosystems). The sequencing template was prepared in a One Touch 2 instrument using an Ion PGM OT2 HiQ View Kit (ThermoFisher Scientific). HTS was performed in an Ion Torrent PGM platform with an Ion 316 Chip Kit v2 BC (ThermoFisher Scientific) using an Ion PGM Hi-Q View Sequencing Kit (ThermoFisher Scientific), according to the manufacturer’s protocols.

The 16S rRNA gene sequencing analysis was performed using tongue coating samples collected from the participants. The V1-V2 region of 16S rRNA genes from each sample was amplified using the following primers: 8F (5′ AGA GTT TGA TYM TGG CTC AG 3′), with Ion Torrent adaptor A and the sample-specific 8-base tag sequence, and 338R (5′ TGC TGC CTC CCG TAG GAG T 3′>), with the Ion Torrent trP1 adaptor sequence. PCR amplification, purification, and quantification of each PCR adaptor were performed as previously described (36 (link)). Emulsion PCR and enrichment of template-positive particles were performed using an Ion PGM Hi-Q View OT2 kit (Thermo Fisher Scientific) with the Ion One Touch 2 system (Thermo Fisher Scientific), and sequencing was performed with the Ion PGM (Thermo Fisher Scientific) using an Ion PGM Hi-Q View sequencing kit (Thermo Fisher Scientific).

The amplicons were purified with AMPureXP magnetic beads (Beckman Coulter, Brea, CA, USA) following the protocol, before the preparation of libraries for sequencing on Ion Torrent PGM. For the library preparation, we used the NEBNext Fast DNA kit (New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions. Barcoding was performed with the NEXTflex kit (Ion Torrent; 64 adapters; PerkinElmer, Inc., Waltham, MA, USA). After the adapters ligation, the purification was conducted using AMPureXP magnetic beads (Beckman Coulter, Brea, CA, USA) again. The last step of library preparation was completing the quantification of the libraries using the KAPA Library Quantification Kit for Ion Torrent Platforms (F. Hoffmann-La Roche Ltd., Basel, Switzerland). All libraries had high quality and were applicable for sequencing.
For conducting an emulsion PCR, preparing and downloading the chip, and adjusting the Ion Torrent Sequencer, we used the Ion PGM Hi-Q View OT2 Kit and the Ion PGM Hi-Q View Sequencing Kit according to protocols (ThermoFisher Scientific, Madison, WI, USA). Libraries loading was performed on the Ion 318 Chip v2 BC chip.

Targeted amplicon NGS for mitochondrial and other neuromuscular disorders was applied for 9 patients with suspected MD. The library preparation was performed using an Ion AmpliSeq Library Kit 2.0 and Ion AmpliSeq™ Neurological Research Panel consisting of 752 genes associated with neurological disorders and including 99 genes related to mitochondrial diseases (Thermo Fisher Scientific, USA; Table S3 (Additional file 1)). Enrichment of exonic sequences was performed with an Ion PGM™ Hi-Q™ View OT2 Kit (Thermo Fisher Scientific, USA) on the Ion OneTouch™ 2 System (Life Technologies, Thermo Fisher Scientific, USA) and sequenced on an Ion PGM™ System (Life Technologies, Thermo Fisher Scientific, USA) using Ion PGM™ Hi-Q™ View Sequencing Kit (Thermo Fisher Scientific, USA) according to the manufacturer’s protocol. Mapping and variants calling were performed using the Ion Torrent Suite™ Server v. 5.0.2 (Thermo Fisher Scientific, USA).

The strains MAFF 212134 and MAFF 212141 (http://www.gene.affrc.go.jp/databases-micro_search_en.php) were picked up as the representative biovar 6 strains for genome sequencing. Their genomes were sequenced and assembled by using the same protocols used in our previous study^{5 (link)}, except that some reagents were different as follows; the Ion PGM Hi-Q View OT2 Kit (Thermo Fisher Scientific Inc.), the Ion PGM Hi-Q View Sequencing Kit (Thermo Fisher Scientific Inc.), and a 318 Chip Kit v2 (Thermo Fisher Scientific Inc.) were used in this study instead of the Ion PGM Template OT2 400 Kit, the Ion Sequencing 400 Kit, and a 318 Chip Kit, respectively. The assembled contigs of MAFF 212134 and MAFF 212141 were annotated using the NCBI PGAP (https://www.ncbi.nlm.nih.gov/genome/annotation_prok/), and registered in the nucleotide sequence databases (DDBJ/EMBL/GenBank).