Myseq platform

Genomic DNA was extracted from 1 g of each environmental sample (mixture of water and sediments for the river samples and solid material for the terraces samples) or 2 mL of each enrichment culture using Ultraclean Soil DNA Isolation Kit (MO BIO Laboratories, Carlsbad, CA, USA), following the manufacturer’s instructions. DNA samples were visualised on a 1% (w/v) agarose gel with ethidium bromide staining and quantified using a NanoDrop spectrophotometer (NanoDrop Technologies, Wilmington, NC, USA). Amplicon sequencing was performed via Molecular Research LP Mr DNA (Shallowater, TX, USA) in the Illumina MySeq platform, targeting the V3–V4 region of the prokaryotic 16S rRNA gene (341F-CCTACGGGNGGCWGCAG- and 785R-GACTACHVGGGTATCTAATCC-primers) for the six environmental samples and the four enrichment cultures and the Internal Transcribed Spacer region of the rRNA genes (ITS1F-CTTGGTCATTTAGAGGAAGTAA- and ITS2R-GCTGCGTTCTTCATCGATGC-primers) was chosen for fungi detection for the six environmental samples and the two heterotrophic cultures.

BRCA1 and
BRCA2 exome sequencing was performed by an external service provider (Admera Health LLC, South Plainfield, NJ, USA) using the proprietary breast cancer panel iBRCA
^TM, which detects genetic variations in all exons of
BRCA1 and
BRCA2. According to the service provider’s description, this panel utilizes the targeted amplicon (166 amplicons) sequencing method, based on Seq-Ready™ TE Panels protocol (WaferGen Biosystems Inc, Freemont, CA, USA). Reagent cocktails and samples were aliquoted into a 384-well sample source plate. The source plate and BRCA1/2 SmartChip™ were pre-dispensed with Seq-Ready™ TE BRCA1/2 Primers and were placed into the SmartChip™ Multisample Nanodispenser. The SmartChip™ was then amplified with Bio-Rad T100 SmartChip™ TE Cycler. PCR product was then purified with Agencourt AMPure XP (Beckman Coulter, Inc.), according to manufacturer’s instructions. Samples were then quantified with Qubit® 2.0 Fluorometer (Thermo Fisher Scientific, Inc.) and quality analyzed with Tapestation (Agilent Technologies). Sequencing was performed with Illumina MySeq platform on a single lane. Raw reads for each sequenced sample were stored in separate fastq files. DNA samples were shipped on ice to avoid degradation and were passed internal quality check before processing.

A 400 bp region of the binding domain of VAR2CSA was amplified by primers listed in Table 1. Samples from the 115 clusters were pooled and PCR amplified in technical duplicates. The forward primer included replicate specific molecular identifiers (MIDs) which allowed amplicon pooling prior to library preparation using the NEBNext Ultra DNA Library Prep Kit for Illumina (New England Biolabs, United States). The Illumina primers included Illumina’s dual barcoding system. This approach enabled multiplexing of pooled samples and libraries into one 2 × 300 sequencing run on the Illumina MySeq platform at the University of North Carolina High Throughput Sequencing Facility.Table 1

Primers used

Forward primer	Reverse primer
ATCATGGTGGAACACGAACA	GTACCCGCTTTACGGTTTCG

To determine the nature of their RNA cargo, 500 μL (2,500 μg of protein per ml) of purified OMVs were first treated with 4 mg of RNAseA (Promega) per ml for 10 min at 37 °C to remove any surface contamination. The added RNase was then inhibited by the addition of 1 μl of Murine RNase inhibitor (NEB). The RNA within these treated OMVs was purified using a mirVana PARIS kit (Invitrogen), followed by DNAse I treatment (Thermo Fisher Scientific). The RNA concentration for each sample was then determined with a Qubit RNA BR assay kit (Invitrogen). Library preparation and sequencing was performed by SeqMatic (Fremont, CA), with paired-end stranded RNA (2 × 75 bp). Size selection of the library with inserts smaller than 300 nucleotides was performed before sequencing on an Illumina MySeq platform. Reads were mapped to the V. fischeri genome (GenBank: CP000020, CP000021, and CP000022), and their relative abundance was estimated with Feature Counts [91 (link)]. Differential-expression analysis was performed using the R package edgeR [82 (link)] with an FDR threshold of 0.05. Heat maps of expression values were originated with the R package heatmap3 [83 (link)].

EGFR mutation analyses were performed on both cytologic and histologic samples, accurately selected by a dedicated expert pathologist from each center at the time of diagnosis. The same DNA specimens were used for the determination of TP53 mutation status, blindly to the clinical outcomes. Quality controls were periodically performed during the course of the study to ensure concordance of molecular results.
DNA was extracted by macro-dissection of an area comprising at least 50% of tumor cells. Cells were lysed in a digestion buffer of 50 mmol/L KCl, 10 mmol/L Tris-HCl pH 8.0, 2.5 mmol/L MgCl₂, and Tween-20 0.45%; proteinase K at 1.25 mg/mL were added to each specimen, with an overnight incubation at 56 °C. After proteinase K inactivation at 95 °C for 10 min, samples were centrifuged twice to eliminate debris and supernatant DNA quantity and quality was assessed by Nanodrop (Celbio) before molecular analyses.
Mutation status for exons 5–8 of TP53 gene was performed by PCR amplification and Direct Sequencing using 3130 Genetic Analyzer (Applied Biosystems, Monza, Italy), or Next-Generation Sequencing by Ion S5 platform (Thermofisher, Monza, Italy), or MySeq platform (Illumina, San Diego, CA, USA).