Psiren retroq retroviral shrna expression vector

HeLa, COS7, and MDCK cells were purchased from American Tissue Type Culture (Rockville, MD) and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS). BS-C-1 cells stably expressing AP-2 σ2-EGFP or LCa (clathrin light-chain A)-EGFP (Ehrlich et al, 2004 (link)) were kindly provided by Tomas Kirchhausen (Harvard Medical School) and cultured in DMEM supplemented with 10% FBS and 1 mg/ml of geneticin (Invitrogen). siRNA or plasmids were transfected into cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Lipofectamine LTX (Invitrogen) or FuGene HD (Roche Diagnostics, Indianapolis, IN) was used to obtain a high expression level of plasmid in HeLa or BS-C-1 cells, respectively. The targeted sequences of siRNA used in this study, the specificity of which has been previously demonstrated, were as follows: girdin (5′-AAGAAGGCTTAGGCAGGAATT-3′), clathrin heavy chain (5′-AATCCAATTCGAAGACCAATT-3′), dynamin 2 (5′-CTGCAGCTCATCTTCTCAAAA-3′). For short hairpin RNA (shRNA)-mediated knockdown of girdin, the targeted sequence 5′-GAAGGAGAGGCAACTGGAT-3′ was inserted into pSIREN-RetroQ retroviral shRNA expression vector (Clontech, Palo Alto, CA) as previously described (Enomoto et al, 2009 (link); Ohara et al, 2012 (link)).

Gastric cancer cell lines MKN45 and KKLS were purchased from the ATCC (Rockville, MD, USA) and provided by the Human Cancer Cell Line Bank (Cancer Research Institute of Kanazawa University, Japan), respectively. Cells were grown in RPMI 1640/10% FBS. For cell proliferation assays, KKLS cells were seeded at 5 × 10⁴ cells per 35‐mm dish; after 12 h, the medium was replaced with RPMI 1640/1% FBS. The cells were counted every 24 h for 3 days. For RNA interference‐mediated depletion (knockdown) of Daple, human Daple‐specific (target sequence, 5′‐TCCAGCTGCGCGTTGTTCAGTGAGG‐3′) and control siRNAs were synthesized by Qiagen (Hilden, Germany). The siRNAs were transfected into MKN45 cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to manufacturer instruction. The target sequences for shRNA mediated Daple knockdown were as follows (only the sense sequence is shown): Daple #1, 5′‐GGTGCAAGCTCGATGTGTA‐3′; Daple #2, 5′‐GCACCAAAGGCTATAACTC‐3′ and Daple #3, 5′‐GCCTGGAGCGTGACAACAA‐3′. The oligonucleotide pairs were inserted into the pSIREN‐RetroQ retroviral shRNA expression vector (Clontech, Palo Alto, CA, USA) to generate recombinant retroviruses as previously described,29 followed by infection of KKLS cells and puromycin selection.