The largest database of trusted experimental protocols

8 protocols using calretinin

1

Immunofluorescence Staining of Paraffin Sections

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 6

Paraffin sections were rehydrated through changes of xylene and graded alcohols. Slides were boiled in 10 mM citrate buffer with 0.05% Tween-20 at pH 6.0 for 20 min. Blocking was preformed with 3% BSA in PBS for one hour. Primary antibodies to PCNA, PECAM-1 (rabbit polyclonal, Santa Cruz), vWF, eNOS, Calretinin, Vimentin (rabbit polyclonal, Abcam), vWF (goat polyclonal, Santa Cruz), FLK-1 (mouse monoclonal, BD Bioscience), CD34, CD45, CD11b (mouse monoclonal, Santa Cruz), alpha-smooth muscle actin (mouse monoclonal, Sigma), and CD8 (rabbit monoclonal Abcam), were diluted to 10 μg/ml in PBS and incubated overnight at 4° C. Slides were washed with three changes of PBS with 0.05% Tween-20 between steps. Appropriate secondary antibodies conjugated to either FITC or Texas Red (Jackson Immunoresearch) were diluted 1:250 and incubated for one hour. The slides were mounted with DAPI-containing mounting medium and visualized on a Nikon Eclipse TE200 fluorescent microscope.

+ Open protocol
+ Expand
2

Immunofluorescence Labeling of Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were immunolabeled as described previously [28 (link)]. Briefly, EBs and cell samples were fixed in 4% paraformaldehyde for 10–15 min, permeabilized with 0.1% Triton X-100/PBS (1X; 140 mM NaCl, 10 mM KCl, 8 mM Na2HPO4, 2 mM KH2PO4, pH 7.4; Thermo Scientific, Rockford, IL) for 10 min, blocked in 4% bovine serum albumin (BSA) for 30 min, and incubated with primary antibodies overnight at 4 °C. The next day, the samples were washed three times with PBS and subsequently incubated with Alexa Fluor 488 or 555 labeled secondary antibody (1:300, Invitrogen) for 30 min at room temperature in the dark. After washing three times with PBS, the samples were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/ml; Molecular Probes, Carlsbad, CA). Primary antibodies Nanog (Cell Signaling, Danvers, MA), Oct3/4, Pax6, Nestin, Tuj, Chx10 (all from Millipore, Temecula, CA), Sox2, ZO1, Rx, calretinin, iSlet1, synaptophysin (all from Abcam, Burlingame, CA), Otx2 (Invitrogen), Chx10 (Santa Cruz, Dallas, TX), and Rx (Santa Cruz) were used at 1:200 dilution. Pax6 (DSHB, Iowa City, IA) was used at 1:50 dilution. Ki-67 (Abcam) and Brn3b (Abcam) were used at 1:1,000 dilution. Fluorescent confocal images were acquired using a laser scanning microscope (LSM 510; Carl Zeiss, Thornwood, NY).
+ Open protocol
+ Expand
3

Dual-Immunofluorescence Staining of Paraffin Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
Dual-immunofluorescence staining was performed on formalin fixed paraffin embedded tissues using antibodies to visualize calretinin (Abcam, Cambridge, UK) and α-SMA (Sigma-Aldrich, St Louis, MO, USA) or pancytokeratin (clone PCK-26; Sigma-Aldrich) and Fsp-1 (Dako, Glostrup, Denmark). The sections were heated to expose the hidden antigens using Real Target Retrieval Solution containing citrate buffer, pH 6.0 (Dako). Secondary antibodies Alexa Fluor 647 and Alexa Fluor 555 (Thermofisher Scientific, Massachusetts, USA) were incubated at room temperature. The nucleus was stained with 4,6-diamidino-2-phenylindole (DAPI) (Thermofisher Scientific). Finally, the preparations were visualized with a LSM710 confocal microscope (Zeiss, Oberkochen, Germany). Negative controls omitting primary antibodies did not give rise to any detectable labelling.
+ Open protocol
+ Expand
4

Immunofluorescence Staining Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 6

Paraffin sections were rehydrated through changes of xylene and graded alcohols. Slides were boiled in 10 mM citrate buffer with 0.05% Tween-20 at pH 6.0 for 20 min. Blocking was preformed with 3% BSA in PBS for one hour. Primary antibodies to PCNA, PECAM-1 (rabbit polyclonal, Santa Cruz), vWF, eNOS, Calretinin, Vimentin (rabbit polyclonal, Abcam), vWF (goat polyclonal, Santa Cruz), FLK-1(mouse monoclonal, BD Bioscience), CD34, CD45, CD11b (mouse monoclonal, Santa Cruz), alpha-smooth muscle actin (mouse monoclonal, Sigma), and CD8 (rabbit monoclonal Abcam), were diluted to 10 μg/ml in PBS and incubated overnight at 4° C. Slides were washed with three changes of PBS with 0.05% Tween-20 between steps. Appropriate secondary antibodies conjugated to either FITC or Texas Red (Jackson Immunoresearch) were diluted 1:250 and incubated for one hour. The slides were mounted with DAPI-containing mounting medium and visualized on a Nikon Eclipse TE200 fluorescent microscope.

+ Open protocol
+ Expand
5

Immunofluorescence and Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The primary antibodies, including indoleamine 2, 3 dioxygenase1 (IDO1), ionized calcium binding adapter molecule 1 (Iba1), glial fibrillary acidic protein (GFAP), T-brain gene-2 (Tbr2), doublecortin (DCX), Prox1, act-casp3, PV, c-Fos, Calretinin, occluding, β-actin, toll-like receptor 4 (TLR4), and NF-κB, were purchased from Abcam, Invitrogen, Santa Cruz Biotechnology, and Cell Signaling Technology companies. The western blot and immunofluorescence procedures were performed following our previous protocols with minor modifications 26 (link). The modification is mainly the adjustment of the antibody dilution.
+ Open protocol
+ Expand
6

Investigating miR-29b-3p in EMT Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The oligonucleotides of miR-29b-3p mimics and negative control miRNA were synthesized by Thermo Fisher Scientific (Waltham, MA). The sequence of the oligonucleotides used for miR-29b-3pmimics.
5′-UAGCACCAUUUGAAAUCAGUGUU-3.
Lipofectamine RNAiMAX was purchased from Invitrogen (Carlsbad, CA). Rabbit mAbs to E-cadherin and calretinin, were purchased from Abcam (Cambridge, UK), Cell Signaling Technology (Danvers, MA). Recombinant- TGF-β1 was purchased from R&D systems (Minneapolis, MN). Rabbit anti-vimentin mAb and anti-rabbit Ig conjugated with AlexaFluor 488 or AlexaFluor 595® were from Invitrogen. DAPI was obtained from Dojindo (Kumamoto, Japan). Anti-integrin β1 mAb and RGD peptide were purchased from Cayman Chemical Co. (Ann Arbor, MI).
All methods were carried out in accordance with guidelines and regulations of the Declaration of Helsinki and all experimental protocols were approved by the Institutional Review Boards of Jichi Medical University (Approval number: RIN-A-19-161).
+ Open protocol
+ Expand
7

Immunofluorescence Analysis of miR-29b Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rabbit mAbs to E‐cadherin, calretinin, and FN, were purchased from Abcam and Cell Signaling Technology. Recombinant TGF‐β1 was purchased from R&D Systems. Rabbit anti‐vimentin mAb and anti‐rabbit IgG conjugated with Alexa Fluor 488 or Alexa Fluor 595, anti‐mouse IgG conjugated with Alexa Fluor 647 were obtained from Invitrogen. We obtained DAPI from Dojindo. Anti‐mouse CD31, CD34, CD44, CD49d, CD73, and CD90 were obtained from BioLegend. Anti‐human CD9 and CD63 were obtained from BD Biosciences. The lentivirus plasmid of miR‐29b precursor and negative control miRNA as well as the pLV‐miRNA Expression Vector System were purchased from Biosettica. The sequence of the oligonucleotides used for miR‐29b precursor (hsa‐mir‐29b‐1) is as follows:
CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG.
+ Open protocol
+ Expand
8

Calretinin and BAP1 Immunohistochemistry

Check if the same lab product or an alternative is used in the 5 most similar protocols
The calretinin and BAP1 immunohistochemistry stainings for diagnostic purposes were obtained from the pathology department and detailed information is available upon request. Briefly, sections were stained for calretinin (Abcam, Cambridge, UK) and BAP1 (Santa Cruz Biotechnology, Dallas, TX) with Ventana Benchmark XT using Optiview detection kit (760-700, Roche, Ventana, Tucson, AZ). The stainings
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!