Log In Sign up
The largest database of trusted experimental protocols

Quickextract dna extraction solution 1

Manufactured by Illumina
Visit Supplier
Sourced in United States

QuickExtract DNA Extraction Solution 1.0 is a laboratory reagent used to extract and purify DNA from various biological samples. It is a simple, rapid, and efficient method for obtaining high-quality DNA for downstream applications, such as PCR, sequencing, or other molecular biology techniques.

Automatically generated - may contain errors

Lab products found in correlation

Axio observer a1, by Zeiss (3 mentions) Taq polymerase, by Qiagen (2 mentions) Qlaquick pcr purification kit, by Qiagen (2 mentions) Q5 high fidelity dna polymerase, by New England Biolabs (2 mentions) Nucleofector kits for human dermal fibroblast, by Lonza (2 mentions) Nucleofector solution and supplement, by Lonza (2 mentions) Cas9 coding pspcas9 bb 2a puro, by Addgene (2 mentions) Accutase, by Thermo Fisher Scientific (2 mentions) 2 4 hydroxyphenyl 5 4 methyl 1 piperazinyl 2 5 bi 1h benzimidazole trihydrochloride hydrate, by Merck Group (2 mentions) Bisbenzimide hepes, by Merck Group (2 mentions) Gotaq dna polymerase, by Promega (2 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Ez 96 dna methylation kit, by Zymo Research (1 mentions) Infinium humanmethylation450k beadchip, by Illumina (1 mentions) Abi prism 7500, by Thermo Fisher Scientific (1 mentions) Taqman snp genotyping assay, by Thermo Fisher Scientific (1 mentions) Bisbenzimide, by Merck Group (1 mentions) E coli o157 h7, by American Type Culture Collection (1 mentions) Qiaamp dna mini kit, by Qiagen (1 mentions)

24 protocols using quickextract dna extraction solution 1

1

Quantifying Virus Particle Concentration and Genomic Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The concentration of infectious virus particles was quantified by a TCID50 assay as described previously [29 (link)]. In addition, the GFP-derived TCID50 titer was obtained by measuring cell fluorescence using a fluorescence microscope (λ 495 nm, Axio Observer A1, Zeiss, Germany). The GFP-assay was carried out immediately before performing the regular TCID50 staining procedure. The PCR was carried out by mixing the infected cell suspension (80 μL) with 20 μL of QuickExtract DNA Extraction Solution 1.0 (Epicentre, USA) and heated to 65°C for 10 min and to 98°C for 5 min. Of this preparation, 4 μL were used in a PCR reaction in a final volume of 20 μL with 0.15 μL Taq polymerase (Qiagen, Germany), 200 nM of each primer, and 125 μM of each nucleotide. The sequence of the primer pairs that span deletion sites II, III and IV of the viral genome have been published previously [30 (link)]. The expected sizes of the amplification products are 354, 447, and 502 bp for wildtype virus deletion sites II to IV, and 1285 for deletion site III in MVA-CR19.GFP. Thermocycling was initiated with 94°C for 80 s, followed by 35 cycles of 94°C for 20 s, 55°C for 20 s and 72°C for 90 s, and terminated with 72°C for 5 min. Amplicons were separated by electrophoreses in 1.5% agarose gels.
Tapia F., Jordan I., Genzel Y, & Reichl U. (2017). Efficient and stable production of Modified Vaccinia Ankara virus in two-stage semi-continuous and in continuous stirred tank cultivation systems. PLoS ONE, 12(8), e0182553.
+ Open protocol
+ Expand
2

Generation and Characterization of Slc38a5 Knockdown αTC1-6 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
αTC1-6 glucagonoma cells were obtained from ATCC (ATCC CRL-2934) and cultured in DMEM (GIBCO, #11965–092) containing 10% (v/v) FBS, 100 U/mL penicillin and 100 μg/mL streptomycin and incubated in a tissue culture incubator at 37°C with a 5% CO2 in air atmosphere. Slc38a5 knockdown αTC1-6 clones were generated using CRISPR-Cas9 technique. Target sequences (sgRNAs) were designed using an online sgRNA design tool from ATUM (https://www.atum.bio/). The sgRNAs were cloned into the pCas9.WT_sgRNA vector using BsmBI (NEB) and αTC1-6 cells were transfected with Lipofectamine 2000, according to the manufacturers’ instructions (Invitrogen, #11668–019). After 72 hr incubation, cells were plated into 96-well plates following serial dilution and expanded for 2–3 weeks. Clones with deletion mutations were verified by PCR amplifications after extracting DNA using QuickExtract DNA Extraction Solution 1.0 (Epicenter, #QE09050), by TaqMan analysis and RNA sequencing. A clone with reduced expression of Slc38a5 (Slc38a5 KD) was used in cell proliferation assay to test the role of Slc38a5 on αTC1-6 cell growth.
Kim J., Okamoto H., Huang Z., Anguiano G., Chen S., Liu Q., Cavino K., Xin Y., Na E., Hamid R., Lee J., Zambrowicz B., Unger R., Murphy A.J., Xu Y., Yancopoulos G.D., Li W.H, & Gromada J. (2017). Amino Acid Transporter Slc38a5 Controls Glucagon Receptor Inhibition-Induced Pancreatic α Cell Hyperplasia in Mice. Cell metabolism, 25(6), 1348-1361.e8.
+ Open protocol
+ Expand
3

Genomic DNA Extraction Using QuickExtract

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was extracted using the QuickExtract DNA Extraction Solution 1.0 (Epicentre, QE09050,) following the manufacturer's protocol. Briefly, pelleted cells were resuspended in 20 μL of QuickExtract Solution, incubated at 65°C for 6 min and 98°C for 2 min.
Valletta S., Dolatshad H., Bartenstein M., Yip B.H., Bello E., Gordon S., Yu Y., Shaw J., Roy S., Scifo L., Schuh A., Pellagatti A., Fulga T.A., Verma A, & Boultwood J. (2015). ASXL1 mutation correction by CRISPR/Cas9 restores gene function in leukemia cells and increases survival in mouse xenografts. Oncotarget, 6(42), 44061-44071.
+ Open protocol
+ Expand
4

Quantifying Gene Editing Efficiency

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA from cell pellets was extracted using QuickExtract DNA Extraction Solution 1.0 (Epicentre). Amplification of the junction regions surrounding gene KI sites in edited cells was carried out by PCR using Q5 High-Fidelity DNA polymerase (New England BioLabs) and 100 ng genomic DNA as template in a 50 μL reaction. PCR products were purified using QlAquick PCR purification kit (Qiagen) and then subjected to direct DNA sequencing service (ACGT, Wheeling, IL). The indel rates were analyzed by the online software12 (link) (http://tide.nki.nl) using sequence without indels as reference.
Yu Y., Guo Y., Tian Q., Lan Y., Yeh H., Zhang M., Tasan I., Jain S, & Zhao H. (2019). An efficient gene knock-in strategy using 5’-modified dsDNA donors with short homology arms. Nature chemical biology, 16(4), 387-390.
+ Open protocol
+ Expand
5

Genomic DNA Extraction and PCR Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was extracted with QuickExtract DNA extraction solution 1.0 (EPICENTRE). PCR was performed under standard conditions. Primers used were Ch2Pmel-F1: ctttagacctccggcactgttgc; Ch2Pmel-R1: gcaagtagcagtgtatcaaatatgc; PmelTCR-R1: gtagctttgtaaggctgtggagag. Ch2Pmel-F1 and Ch2Pmel-R1 amplify a transgenic band of 308 bp. Ch2Pmel-F1 and PmelTCR-R1 amplify an endogenous band of 203 bp.
Ji Y., Abrams N., Zhu W., Salinas E., Yu Z., Palmer D.C., Jailwala P., Franco Z., Roychoudhuri R., Stahlberg E., Gattinoni L, & Restifo N.P. (2014). Identification of the Genomic Insertion Site of Pmel-1 TCR α and β Transgenes by Next-Generation Sequencing. PLoS ONE, 9(5), e96650.
+ Open protocol
+ Expand
6

PCR-based Detection of Viral Genome Deletions

Check if the same lab product or an alternative is used in the 5 most similar protocols
80 µL of complete cell lysate was mixed with 20 µL of QuickExtract DNA Extraction Solution 1.0 (Epicentre, USA) and heated to 65 °C for 10 min and to 98 °C for 5 min. 4 µL of this preparation was subjected to PCR in a final volume of 25 µL with 0.15 µL Taq polymerase (Qiagen, Germany), 200 nmol/L each primer, and 125 µmol/L each nucleotide. The sequence of the primer pairs that span deletion sites I–VI of the viral genome were obtained from the literature (Kremer et al. 2012 (link)). The expected sizes of the amplification products are 291, 354, 447, 502, 603, and 702 bp for wildtype virus deletion sites I to VI (Kremer et al. 2012 (link)), and 1285 for deletion site III in MVA-CR19.GFP. Thermocycling was initiated with 94 °C for 80 s, followed by 35 cycles of 94 °C for 20 s, 55 °C for 20 s and 72 °C for 90 s, and terminated with 72 °C for 5 min. Amplicons were separated by electrophoreses in 1.5% agarose gels.
Jordan I., Horn D., Thiele K., Haag L., Fiddeke K, & Sandig V. (2019). A Deleted Deletion Site in a New Vector Strain and Exceptional Genomic Stability of Plaque-Purified Modified Vaccinia Ankara (MVA). Virologica Sinica, 35(2), 212-226.
+ Open protocol
+ Expand
7

Infant Buccal Swab DNA Methylation

Check if the same lab product or an alternative is used in the 5 most similar protocols
A buccal swab was performed on the infants and subsequently DNA was extracted using QuickExtract DNA Extraction Solution 1.0 (Epicentre Biotechnologies, Madison, WI, USA). DNA quality was assessed by using Agilent Genomic DNA ScreenTape System and DNA concentration was measured using Qubit fluorometer. DNA was stored in – 20 °C for further analysis. 500 ng of genomic DNA was bisulfate converted with EZ-96 DNA Methylation kit (Zymo Research, Irvine, CA, USA) and genome wide DNA methylation analysis was performed using the Infinium Human Methylation 450 K BeadChip (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions.
Henriksson P., Lentini A., Altmäe S., Brodin D., Müller P., Forsum E., Nestor C.E, & Löf M. (2020). DNA methylation in infants with low and high body fatness. BMC Genomics, 21, 769.
+ Open protocol
+ Expand
8

Precise CRISPR Editing of iPSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmids were electropoated using Nucleofector™ Kits for Human Dermal Fibroblast (Lonza) according to the manufacturer’s protocol. Briefly, after washing with PBS, iPSCs were treated with Accutase (Life Technologies) to dissociate single cells. These cells were suspended with Nucleofector solution and Supplement (Lonza) and mixed with gRNA expression vector, Cas9 coding pSpCas9(BB)-2A-Puro (Addgene) and double-strand plasmid DNA for donor. The donor plasmid was constructed by cloning the flanking regions of rs3851179 amplified by primers as follows; F: 5′- ACCCATCACCCTTCTGTTTG-3′ and R: 5′-TTTTCCAGCAAGTTGGGTTC-3′. Puromycin selections were started at 24 hours after electroporation and continued 3 to 4 days at the concentration of 0.75 µg/mL. After withdrawal of puromycin, cells were cultured in mTeSR until suitably sized colonies appeared. Colonies were picked up and genomic DNAs were extracted using QuickExtract™ DNA Extraction Solution 1.0 (epicentre) according to manufacturer’s protocol. Target site was amplified by PCR using primers as follows; F: 5′- CCCGCTTCATAGGGTTATTG-3′ and R: 5′- AACTCACCCCAGTCTCTTGC-3′. We confirmed suspected mutant clones by direct sequencing of the PCR products. We used Sanger sequencing of iPSCs at rs3851179 to verify independent isogenic lines homozygous for either the G or A variant.
Zhao Z., Sagare A.P., Ma Q., Halliday M.R., Kong P., Kisler K., Winkler E.A., Ramanathan A., Kanekiyo T., Bu G., Owens N.C., Rege S.V., Si G., Ahuja A., Zhu D., Miller C.A., Schneider J.A., Maeda M., Maeda T., Sugawara T., Ichida J.K, & Zlokovic B.V. (2015). Central role for PICALM in amyloid–β blood–brain barrier transcytosis and clearance. Nature neuroscience, 18(7), 978-987.
+ Open protocol
+ Expand
9

Precise CRISPR Editing of iPSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmids were electropoated using Nucleofector™ Kits for Human Dermal Fibroblast (Lonza) according to the manufacturer’s protocol. Briefly, after washing with PBS, iPSCs were treated with Accutase (Life Technologies) to dissociate single cells. These cells were suspended with Nucleofector solution and Supplement (Lonza) and mixed with gRNA expression vector, Cas9 coding pSpCas9(BB)-2A-Puro (Addgene) and double-strand plasmid DNA for donor. The donor plasmid was constructed by cloning the flanking regions of rs3851179 amplified by primers as follows; F: 5′- ACCCATCACCCTTCTGTTTG-3′ and R: 5′-TTTTCCAGCAAGTTGGGTTC-3′. Puromycin selections were started at 24 hours after electroporation and continued 3 to 4 days at the concentration of 0.75 µg/mL. After withdrawal of puromycin, cells were cultured in mTeSR until suitably sized colonies appeared. Colonies were picked up and genomic DNAs were extracted using QuickExtract™ DNA Extraction Solution 1.0 (epicentre) according to manufacturer’s protocol. Target site was amplified by PCR using primers as follows; F: 5′- CCCGCTTCATAGGGTTATTG-3′ and R: 5′- AACTCACCCCAGTCTCTTGC-3′. We confirmed suspected mutant clones by direct sequencing of the PCR products. We used Sanger sequencing of iPSCs at rs3851179 to verify independent isogenic lines homozygous for either the G or A variant.
Zhao Z., Sagare A.P., Ma Q., Halliday M.R., Kong P., Kisler K., Winkler E.A., Ramanathan A., Kanekiyo T., Bu G., Owens N.C., Rege S.V., Si G., Ahuja A., Zhu D., Miller C.A., Schneider J.A., Maeda M., Maeda T., Sugawara T., Ichida J.K, & Zlokovic B.V. (2015). Central role for PICALM in amyloid–β blood–brain barrier transcytosis and clearance. Nature neuroscience, 18(7), 978-987.
+ Open protocol
+ Expand
10

Genotyping of ADAR1 SNPs from Genomic DNA

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was extracted from anus or cervical samples38 (link) using the QuickExtract™ DNA Extraction Solution 1.0 (QE09050, Epicentre Biotechnologies). Extracted DNA was used for each genotyping. Six ADAR1 SNPs (rs6699729, rs3766927, rs3766925, rs3766924, rs9616 and rs9427097) were selected based on linkage disequilibrium testing and cover all described variation in ADAR1 gene23 (link),42 (link). The variants were typed using TaqMan SNP genotyping assay (Assay num: C__30114879_10, C__11259682_10, C___222942_10, C__25800598_10, C___8724401_10 and C__303121822_10, respectively, Applied Biosystems) following manufacturer’s protocol. Reactions were analyzed on an ABI PRISM 7500 (Applied Biosystems) and allele calling was performed by AutoCaller Software v 1.1 (Applied Biosystems).
Genotyping data, minor allele frequency and Hardy-Weinberg equilibrium of selected SNPs are found in Supplementary Table 1.
Pujantell M., Badia R., Galván-Femenía I., Garcia-Vidal E., de Cid R., Alcalde C., Tarrats A., Piñol M., Garcia F., Chamorro A.M., Revollo B., Videla S., Parés D., Corral J., Tural C., Sirera G., Esté J.A., Ballana E, & Riveira-Muñoz E. (2019). ADAR1 function affects HPV replication and is associated to recurrent human papillomavirus-induced dysplasia in HIV coinfected individuals. Scientific Reports, 9, 19848.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!