Aceq qpcr sybr green

To gain RNA samples, organoids were transferred into a 1.5-ml tube, centrifuged and washed with PBS. Cells were lysed with 350 µl RLT buffer (RNeasy Plus Micro Kit; Qiagen) followed by homogenization using a pistil. RNA isolation and cDNA synthesis was done exactly as described for 2D cultures [27 (link)]. Gene expression was measured on a QuantStudio 7 Real-Time PCR system (Applied Biosystems) using SYBR green chemistry (AceQ qPCR SYBR Green, Vazyme Biotech). Primer sequences are provided in Supplementary Table S2. Expression levels were calculated using the comparative relative quantification (ΔΔC_T) method and β-actin (ACTB) as endogenous control, which showed a comparable expression pattern among samples (Supplementary Figure S6).

Hearts were freshly isolated from anaesthetized zebrafish subjected to sham surgery or resection at different time points. The outflow tracts and atriums were removed from the isolated hearts. Total RNA was extracted from approximately 4 to 6 isolated ventricles from each group using TRIZOL reagent (Invitrogen,15596026). For the experiments in zebrafish embryos, total RNA was isolated from 40 to 60 embryos in each group. About 1 μg isolated RNA was treated with DNaseI (NEB, M0303S) prior to reverse transcription and purified through lithium chloride. First-strand cDNA was synthesized using M-MLV Reverse Transcriptase (Invitrogen, C28025021). The reaction was performed using a CFX96^TM Real-Time System (Bio-Rad, America) with AceQ qPCR SYBR Green (Vazyme, Q111–02) according to the manufacturer’s instructions. Total RNA levels were normalized to the level of gapdh. Statistics were obtained from three repeats.
The primer sequences of the analyzed genes are listed as follows: slc2a1a qRT-PCR primer (TTGTGGGTCTTTACTCGGGC;ATGAGGAGGTATCGTGGGCT); cmyc qRT-PCR primer (GGATCTGAGCACCTCTGCAT;CGACTCTGAAGCATCCGTCT); gapdh qRT-PCR primer (TTCCAGTACGACTCCACCCA;TGACTCTCTTTGCACCACCC); β-actin qRT-PCR primer (CATTGGCAATGAGCGTTTC;TACTCCTGCTTGCTGATCCAC).

Extracellular matrix (ECM) media were purchased from ScienCell. RPMI-1640 media was purchased from Gibco (Thermo Fisher Scientific, Waltham, MA, USA). Trizol was purchased from Sigma-Aldrich (Sigma-Aldrich, Burlington, MA, USA). Hiscript QRT Supermix for quantitative PCR (qPCR) and AceQ qPCR SYBR Green was purchased from Vazyme (Nanjing, China). Antibodies (TRIM22, Beclin1, P62, ATG7, ATG5, mTOR, P-mTOR, AMPK, P-AMPK, ERK, P-ERK, and GAPDH) were purchased from Abcam (Abcam, Cambridge, UK). Age I and EcoRI were purchased from NEB (New England Biolabs, Ipswich, MA, USA). The BCA Protein Assay Kit was purchased from HyClone-Pierce, Inc (Thermo Fisher Scientific). Real-time fluorescence quantitative polymerase chain reaction (PCR) was purchased from ABI (StepOne PLUS, Thermo Fisher Scientific). The gel imager was purchased from Bio-Rad (Bio-Rad, Hercules, CA, USA). The ultraviolet–visible spectrophotometer was purchased from Thermo Fisher Scientific. The chemiluminescence imaging system used was a GE AI600. The microplate reader was purchased from Bio-Rad.

Zebrafish telencephalons were isolated immediately after anesthetization at different ages (3, 6, 10 months). The total RNA was extracted from six to eight telencephalons in each group using Trizol reagent (Invitrogen, 15596026). Isolated RNA was treated with DNaseI (NEB, M0303S) prior to reverse transcription and purified through lithium chloride.
For the analysis of mRNAs, the first-strand cDNA was synthesized using M-MLV Reverse Transcriptase (Invitrogen, C28025021). The quantitative PCR was performed with AceQ qPCR SYBR Green (Vazyme, Q111-02) using CFX96^TM Real-Time System (Bio-Rad) according to the manufacturer’s instructions. The total RNA levels were normalized to the level of β-actin. Statistics were obtained from three repeats. The primer sequences used in this study are listed in Supplementary Table S1.
For the analysis of miRNAs, the reverse transcription reaction was performed with miRcute Plus miRNA First-Strand cDNA Synthesis Kit (TIANGEN, KR211). The quantitative PCR was performed with miRcute Plus miRNA qPCR Detection Kit (TIANGEN, FP411) using CFX96^TM Real-Time System (Bio-Rad). The total RNA levels were normalized to the level of U6. The forward primer sequences of the analyzed miRNAs are listed in Supplementary Table S1, and the reverse primers were supplied by the miRcute Plus miRNA qPCR Detection Kit.