Expand high fidelity polymerase

Total RNA from different primary cultures and cell lines was isolated using the SV Total RNA Isolation System, and cDNA was generated using 1 mg of RNA, M-MLV Reverse Transcriptase, and oligo dT₍₁₅₎ primers, according to the indications stated by the manufacturer (Promega Corporation, Madison, WI, United States). To simultaneously detect the different splice variants of the TβRII receptor, PCR amplification was performed in the presence of Expand High Fidelity polymerase (Roche Diagnostics GmbH, Mannheim, Germany), 0.2 mM dNTPS, and 0.5 μM of each primer (forward: 5′ACCGGTATGGGTCGGGGGCTGCTC3′ and reverse: 5′GT CGACTCAGTAG CAGTAGAAGATG3′) for 35 cycles using the following PCR conditions: 1 min at 95°C, 1 min at 55°C, and 1 min at 95°C.

To confirm the detection of the two forms of LAPTM4B protein with our antibodies, overexpression experiments in mammalian cells were performed. The LAPTM4B open reading frame was amplified by PCR using the Expand High Fidelity polymerase (Roche Molecular Biochemicals) with specific LAPTM4B primers. The PCR fragment was purified and cloned into pQE-TriSystem His-Strep2 (Qiagen). The final construct pQE2-LAPTM4B was used to transfect HEK cells using the CalPhos mammalian transfection kit (Clontech Laboratories, Inc.) according to the manufacturer’s protocol. Seventy-two hours post-transfection, cells were harvested and protein extraction as well as immunoblotting was performed as described above using the anti-LAPTM4B antibody generated from the present study and a commercial anti-LAPTM4B antibody (Abcam Inc.; cat. # ab82810, at a concentration of 1 μg/ml). To verify for ubiquitination of the LAPTM4B protein, immunoblotting was also performed using a monoclonal anti-ubiquitin antibody (Sigma U0508 at 1:2,500 dilution). Immunoreactive proteins were visualized by incubation with horseradish peroxidase-linked sheep anti-mouse secondary antibody (1:20 000 dilution) and the enhanced chemiluminescence system, ECL plus (GE Healthcare Life Sciences) according to the manufacturer’s protocol followed by revelation using the ChemiDoc XRS+ system (Bio-Rad).

Oligonucleotides used for plasmids construction and information about the construction strategies are available upon request. DNA manipulations were performed as described (Sambrook et al., 1989 ), or with the Getaway cloning system (Life Technologies) in the case of lentiviral vectors. Enzymes for molecular biology were obtained from New England Biolabs. Plasmids were purified with the Nucleospin plasmid purification kit (Macherey-Nagel 740422.10). Linear DNA was purified from agarose gels using the gel extraction kit from Qiagen. Polymerase chain reactions (PCRs) were performed with the Expand High Fidelity polymerase (Roche) and a TRIO-thermoblock (Biometra GmbH). Plasmids used are listed in Table 1. E. coli DH5α (Chan et al., 2013 (link)) was used to amplify plasmids. All plasmids generated in this work are available for non-commercial purposes under request.