Exponential phase E. coli B2 were incubated with thymine (0–10 mM) for 4 h. Total RNA was extracted reverse transcribed to cDNA using the PrimeScriptTM RT reagent Kit with gDNA Eraser (Takara). RT-PCR analysis was performed on a 7500 Fast Real-Time PCR System (Applied Biosystem, CA, United States) using the TB Green qPCR Kit (Takara) with the optimized primers (Supplementary Table S2 ). Relative quantitative method was applied to calculated the fold changes of mRNA expression relative to the housekeeping gene rpoC (for: GTACGTTCCACATCGGTGGT; rev: CAACCGACTTCACGTTGCTG) (Yang et al., 2020 (link)).
Tb green qpcr kit
Manufactured by Takara Bio
Sourced in United States, Japan
The TB Green qPCR Kit is a reagent kit for performing quantitative real-time PCR (qPCR) analysis. It contains all the necessary components, including a DNA-binding fluorescent dye, to conduct sensitive and specific qPCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
7500 fast real time pcr system, by Thermo Fisher Scientific (4 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (2 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Lightcycler 480 2, by Roche (1 mentions)
Rt reagent kit, by Takara Bio (1 mentions)
Primescript rt reagent kit with gdna eraser, by Vazyme (1 mentions)
Lightcycler 480 real time pcr system, by Roche (1 mentions)
Hiscript 3 1st strand cdna synthesis kit, by Vazyme (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
Applied biosystems 7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Rna extraction kit, by Takara Bio (1 mentions)
8 protocols using tb green qpcr kit
1
Quantifying Thymine-Induced E. coli Transcripts
2
Quantitative Analysis of Gene Expression in Lung Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from lung cells using the RNeasy plus Mini Kit (Qiagen, Maryland, USA). Reverse transcription (RT) was performed with 500 ng of total RNA using the BeyoRT™ III cDNA synthesis kit (Cat. No. D7178M, Beyotime, Shanghai, China). qPCR was performed with the cDNA samples using the TB Green qPCR Kit (Takara) in the 7500 Fast Real-Time PCR System (Applied Biosystem, CA, USA). The qPCR reaction conditions included initial denaturation at 94 °C for 5 min followed by 40 cycles of amplification at 94 °C for 30 s, 58 °C for 30 s and 72 °C for 30 s. The reaction was stopped at 25 °C for 5 min. Relative gene expression levels were analyzed using the 2−ΔΔCt method. GAPDH was used as an endogenous control. RT-PCR primers used in this study are listed in Table 1 .
QPCR primers used in the study
| Genes | Primer | Sequence (5' → 3') |
|---|---|---|
| CXCL2 | Forward | GAAAGCTTGTCTCAACCCCG |
| Reverse | TGGTCAGTTGGATTTGCCATTTT | |
| CXCL1 | Forward | AGCTCTTCCGCTCCTCTCA |
| Reverse | CACGGACGCTCCTGCTG | |
| IL-6 | Forward | CCTTCTCCACAAGCGCCTTC |
| Reverse | GGAAGGCAGCAGGCAACA | |
| Caspase9 | Forward | CTGCACTTCCTCTCAAGGCA |
| Reverse | AGCATTGGCAACCTGGGAAG | |
| AMPK | Forward | AAAGTCGGCGTCTGTTCCAA |
| Reverse | GGGCCTGCATACAATCTTCCT |
3
Gene Expression Analysis of Tight Junction Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol reagent (Invitrogen, USA, ref#15596018). An RT reagent kit (TAKARA, Japan, ref#RR047A) was used to reverse-transcribe RNA into cDNA. A TB Green qPCR kit (TAKARA, Japan, ref#RR420A) was used to carry out the real-time qPCR reactions. The process was controlled and the result was analyzed on the qPCR instrument (Roche, LightCycler® 480II). All the experiments were performed in triplicate and β-Actin was selected as the reference gene for mRNA. The specific primer sequences (Occludin, ZO-1, JAM-1, and β-Actin) used for amplification are listed in Table 1
4
Colistin and SC Effects on E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Early‐exponential phase of E. coli G92 was exposed to colistin (0.5 µg mL−1) alone or in combination with SC (2 mg mL−1) for 4 h. After that, total RNA was extracted and measured using the 260/280 nm absorbance ratio. Using the PrimeScript RT reagent Kit with gDNA Eraser (Vazyme, Nanjing), reverse transcription of 1 µg of extracted RNA was carried out following the manufacturer's instructions. RT‐qPCR analysis was performed by 7500 Fast Real‐Time PCR System (Applied Biosystem, CA, USA) using the TB Green qPCR Kit (Takara) with the optimized primers (Table S3 , Supporting Information). The fold changes in mRNA expression relative to the reference genes (16S rRNA) in E. coli were calculated using a relative quantitative technique.
5
Quantitative PCR for Bacterial Abundance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative PCR was performed using the TB Green qPCR Kit (Takara, Tokyo, Japan) and LightCycler 480 Real-Time PCR system (Roche, Shanghai, China). Relative abundance of each bacterium was calculated by the ΔCt method and normalized to total bacteria (16S rRNA). The primer sequences are listed in Table S1 .
6
Quantification of Gene Expression by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs from cells and tissues were extracted with RNAiso Plus (TaKaRa). Reverse transcriptions were completed using a HiScript III 1st Strand cDNA synthesis kit (Vazyme). Reverse transcription-quantitative PCR (RT-qPCR) was performed by using a TB Green qPCR kit (TaKaRa) in the Applied Biosystems 7500 fast real-time PCR system (Life Technologies). All primers are shown in Table 2 . The GAPDH (glyceraldehyde-3-phosphate dehydrogenase) gene was quantified as the reference gene.
7
Colistin and Melatonin Modulate E. coli Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
E. coli B2 were grown to early-exponential phase, and incubated with colistin (40 μg/mL) alone or in combination of melatonin (1 mg/mL) for 4 h. Then, total RNA was extracted and quantified by the ratio of absorbance (260 nm/280 nm). Reverse transcription of 1 μg extracted RNA was performed using the PrimeScript™ RT reagent Kit with gDNA Eraser (Takara, Dalian, China) following the manufacturer's protocol. RT-PCR analysis was performed by 7500 Fast Real-Time PCR System (Applied Biosystem, CA, USA) using the TB Green qPCR Kit (Takara) with the optimized primers (Table S4 ) . Relative quantitative method was applied to calculate the fold changes of mRNA expression relative to the reference genes (16S rRNA) in E. coli.
8
EMO-induced gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MH7A cell were incubated with 80*M EMO for 24 h. RNA was then extracted from the cells with a Takara RNA Extraction Kit (Cat# 9767, Japan), following the instructions given by the manufacturer. RNA was subjected to reverse transcription to obtain cDNA. RT-PCR was conducted using the TB Green qPCR kit (Cat# RR420A, Takara, Japan) following the 20 ructions provided by the manufacture. In the PCR method, initialization was performed at 95°C for 5 min, then denatured at 95°C for 39 cycles and a period of 30 s, 15 s of annelation at 55°C, and further extended for 30 sat 72°C. The 2−ΔΔCt method was used for analysis of 19 expression data. Primer sequences applied in RT-PCR are presented in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!