Ribogreen

For RT–qPCR RNA was extracted from DRG neurons cultured in Boyden chambers as previously described (Willis & Twiss, 2011 (link)). cDNA was prepared from 500 ng of RNA, using SuperScript™ III First‐Strand Synthesis System (Thermo Scientific, 18080051). Quantitative real‐time PCR (qPCR) was performed using the PerfeCTa SYBR green FastMix (Quanta Biosciences) and gene‐specific primers for Inpp5f and Gapdh, on the ViiA‐7 system (Thermo Fisher Scientific). For RT‐ddPCR, RNA was isolated from DRG neurons, using RNeasy Microisolation Kit (QIAGEN). Fluorimetry with Ribogreen (Life Technologies) was used for RNA quantification; 20 ng of RNA was used for reverse transcription (RT) with SensiFAST cDNA synthesis kit (Bioline) according to the manufacturer’s protocol. ddPCR was performed using custom Ncl mRNA‐specific primer sets (IDT; forward primer: 5′CGGAAGAGGCGGATTTGG3′; reverse primer: 5′GGAAAGAATGGGATGGAAGGA3′) and detected with Evagreen using a QX200TM droplet reader (Bio‐Rad).

At 24 h post-transfection, total RNA was isolated using TRIzol (Life Technologies) per the manufacturer's instructions. Briefly, growth medium was removed from cells, and cells were washed once with PBS. TRIzol was added directly to the plate, and cells scraped and harvested. The aqueous phase of a phenol-chloroform extraction was mixed with isopropanol to precipitate the total RNA. The RNA was further treated with DNase I (Life Technologies) to avoid false-positives caused by DNA contamination and then re-precipitated. For RT-qPCR, 1–2ug total RNA was used to synthesize cDNA using StepOne Real-Time PCR System at 48°C for 30 mins, followed by qPCR using Express One–Step Superscript RT-qPCR Kit (Life Technologies). Primer probe sets include 2 primers (a forward and reverse) as well as an internal probe and were selected to be either upstream or downstream of the amplicon site (Supplementary Figure S1). For all RT-qPCR reactions, we report means and standards deviations from 3 independent experiments with triplicate samples in each experiment and the data are normalized to Ribogreen (Life Technologies). The primer probe sets used in RT-qPCR are listed in Supplementary Figure S1 and Supplementary Materials.

Peripheral blood plasma or bone marrow plasma was filtrated with a sterile syringe filter with a 0.45-μm pore size membrane to remove cells. Total RNA was extracted from plasma with RNAiso Blood (Takara Bio, Shiga, Japan) according to manufacturer's instructions. The extracted RNA was quantitated with the fluorescent dye RiboGreen and a Qubit 3.0 Fluorometer (Life Technologies, Carlsbad, USA) according to manufacturer's protocol.
Blood samples from 40 healthy persons were obtained in Niitsu Medical Center Hospital, and blood and bone marrow samples from four myeloma patients were in Niigata Cancer Center Hospital. Written informed consent was obtained from each person, and this study was approved by the ethics committee of Niigata University of Pharmacy and Applied Life Sciences (Permit Numbers: H28–008 and H29-007) according to Ethical Guidelines for Medical and Health Research Involving Human Subjects (Public Notice of the Ministry of Education, Culture, Sports, Science and Technology and the Ministry of Health, Labour and Welfare, Japan, No. 3 of 2014).