Toxinsensor endotoxin detection system

Serovar 8 of U. urealyticum (Uu8) and serovar 3 of U. parvum (Up3) were acquired from the American Tissue Culture Collection (ATCC; Uu8: ATCC 27618, Up3: ATCC 27815). Isolates were propagated in a liquid in-house medium (“broth”) containing 82% autoclaved pleuropneumonia-like organism medium (Becton, Dickinson & Company, Franklin Lakes, NJ, USA), 10% heat-inactivated horse serum (v/v), 1% urea (w/v), and 0.002% phenol red (w/v) (all: Sigma-Aldrich, St. Louis, CA, USA). The medium was passed through a 0.2 µm filter membrane (Sartorius, Goettingen, Germany) and adjusted to pH 6.5. An endotoxin level of <0.06 EU/mL was verified (ToxinSensor™ Endotoxin Detection System, GenScript, Piscataway, NJ, USA).
As described previously [26 (link)], 10-fold serial dilutions of ureaplasma cultures were incubated to obtain 1 × 10⁹–1 × 10¹⁰ color-changing units (CCU)/mL of viable organisms. The corresponding ureaplasma DNA amounted to 5 × 10⁷–6 × 10⁸ copies/mL (Institute of Medical Microbiology and Hospital Hygiene, Duesseldorf, Germany). Bacterial viability was confirmed by simultaneous culture on selective agar plates (Mycoplasma ureaplasma agar, medco Diagnostika GmbH, Ottobrunn, Germany).

Based on the structure of calreticulin, full-length TsCRT (TsCRT, 22–413 amino acids (aa)) and its various domain fragments were expressed as recombinant proteins in Escherichia coli. The domain fragments included the NP-domain (22–331 aa), P-domain (TsCRT-P, 172–331 aa), C-domain (TsCRT-C, 332–413 aa), and S-domain, a potential C1q binding site spanning the N and P domains (TsCRT-S, 135–288 aa) (Figure 2A). The DNA sequences encoding these fragments were subcloned into the pET-24a bacterial expression vector (Novagen, Darmstadt, Germany) using the specific primers listed in Table 1. Recombinant plasmids with confirmed correct sequences were transformed into E. coli BL21(DE3). Recombinant fragments with c-terminal His-tags (rTsCRT, rTsCRT-NP, rTsCRT-P, rTsCRT-S, and rTsCRT-C) were expressed by induction using 1 mM IPTG at 37°C for 3.5 h, and then purified by Ni-affinity chromatography (Novagen, Madison, USA). Endotoxin contaminating the purified recombinant proteins was removed using Pierce High Capacity Endotoxin Removal Resin (Invitrogen, Carlsbad, CA, USA), and endotoxin removal was confirmed using the ToxinSensor Endotoxin Detection System (GenScript, Nanjing, China). The concentration of purified proteins was measured using a BCA Protein Assay Kit (Thermo Fisher, Carlsbad, USA).

U. urealyticum serovar 8 (Uu8) and U. parvum serovar 3 (Up3) were acquired from the American Tissue Culture Collection (ATCC; Uu8: ATCC 27618, Up3: ATCC 27815). As described previously [31 (link)], ureaplasma isolates were cultured in a liquid in-house medium (“broth”) containing 82% autoclaved pleuropneumonia-like organism medium (Becton, Dickinson & Company, Franklin Lakes, NJ, USA), 10% heat-inactivated horse serum, 1% urea, and 0.002% phenol red (all: Sigma-Aldrich, St. Louis, CA, USA). The medium was adjusted to pH 6.5 after passage through a 0.2-μm filter membrane (Sartorius, Goettingen, Germany). Using the ToxinSensor™ Endotoxin Detection System (GenScript, Piscataway, NJ, USA), we could verify an endotoxin level < 0.06 EU/ml broth. Serial 10-fold dilutions of the ureaplasma cultures were incubated for 18–20 h to obtain titers of 1 × 10⁹–1 × 10¹⁰ color-changing units (CCU)/ml of viable organisms.

ureaplasma (U.) urealyticum serovar 8 and U. parvum serovar 3 were obtained from the American Tissue Culture Collection (ATCC, Manassas, VA; serovar 8: ATCC 27618, serovar 3: ATCC 27815). Isolates were cultured in in-house modified 10-B medium [32 (link)] (referred to as “broth”), containing 82% pleuropneumonia-like organism medium (Becton, Dickinson & Company, Franklin Lakes, NJ), 10% heat-inactivated horse serum (v/v), 1% urea (w/v) and 0.002% phenol red (w/v) (all: Sigma-Aldrich, St. Louis, CA), adjusted to pH 6.5. An endotoxin level < 0.06 EU/mL broth was verified using ToxinSensor Endotoxin Detection System (GenScript, Piscataway, NJ). Serial 10-fold dilutions were incubated for 18–20 h to achieve titers of 1×10⁹−1×10¹⁰ color-changing units (CCU)/mL of viable cells.

Based on the sequence information of T. spiralis calreticulin (Ts-CRT) (XM_003371331.1), a pair of specific primers (forward: 5′GCGGATCCGAGCCGACCATTTACCTCAAGGAAAC3′ and reverse: 5′GCCTCGAGCAGCTCTTCTTTAACATT3′) were designed to amplify Ts-CRT coding DNA without signal at the 5′-end from adult parasite total cDNA. The amplified Ts-crt DNA was subcloned into E. coli expression vector pET-28a (Novagen, Darmstadt, Germany). The rTs-CRT was expressed in E. coli BL21 (DE3) under induction of 0.5 mM IPTG at 37°C for 4 h. The soluble rTs-CRT with His-tags at both N- and C-terminuses was purified by Ni-affinity chromatography (Novagen) following the manufacturer’s protocols. The rTs-CRT purity was analyzed by SDS-PAGE and confirmed by Western blotting with anti-His antibody (TIANGEN, Beijing, China). The rTs-CRT concentration was determined using BCA Protein Assay Kit (Thermo, Waltham, MA, USA). The contaminated endotoxin in purified rTs-CRT was removed using ToxOut Endotoxin Removal Kits (BioVision, San Francisco, CA, USA) and confirmed using the ToxinSensor Endotoxin Detection System (GenScript, Nanjing, China).

PM2.5 stock solution was prepared by dissolving standard reference PMs (SRM 1648a) (50 mg; NIST, Gaithersburg, MD, USA) in 500 µL phosphate buffer solution (PBS) and 500 µL dimethyl sulfoxide (DMSO) and subjected to ultrasound oscillation on ice for 30 min through ultrasonography. Then Toxinsensor™ Endotoxin Detection System (GenScript Biotech, Nanjing, China) was applied to test endotoxin levels.

To investigate the effects of a-PDT on LPS, we adjusted the specimens by adding toluidine blue to the LPS solution such that the final concentration of LPS was 1 EU/mL and the final concentration of toluidine blue was 0.01%. After applying light with a Fotoso630^® from the test tube base for 0, 1, 2, and 5 min, the toluidine blue was removed using a spin gel filtration column. LPS detection was performed in accordance with the Toxin Sensor Endotoxin Detection System (GenScript USA Inc, Piscataway, NJ, USA) manual. We then transferred 100 µL of each of the specimens into a 96-well multi-plate and measured absorbency with a wavelength of 545 nm.