Negative selection mouse b cell isolation kit

B cells were isolated from WT and Il12a^GFP mouse spleens using a negative selection mouse B cell isolation kit (StemCell Technologies, #19854). RNA was purified from isolated B cells using the RNeasy mini kit (Qiagen, 74134). RNA was normalized to 1ug total RNA and cDNA were generated using the Maxima First Strand cDNA Synthesis Kit (Thermo Scientific, K1671). qPCR analysis was performed using PerfeCTa SYBR Green SuperMix (Quanta Biosciences) and the Applied Biosystems (ABS) 7500 real-time PCR system. Results were normalized to the expression of β-Actin and then calculated using ∆∆CT. All samples were run in triplicate. Primer sequences used for qPCR are β-Actin FWD 5’-GGCTGTATTCCCCTCCATCG–3’, β-Actin REV 5’-CCAGTTGGTAACAATGCCATGT-3’, Il12a FWD 5’-CATCGATGAGCTGATGCAGT-3’, Il12a REV 5’-CAGATAGCCCATCACCCTGT-3’, emGFP FWD 5’- GACCACCTTGACCTACGGCG - 3’, emGFP REV 5’ – CCCTCGAACTTCACCTCGGC – 3’.

B cells were isolated from Il12a^GFP and Ebi3^Tom mouse spleens using a negative selection mouse B cell isolation kit (StemCell Technologies, #19854). B cells were seeded in a 48-well plate (1e⁶/ml) in RPMI containing 10% heat-inactivated serum, 1x pen/strep, and B-mercaptoethanol. Cells were stimulated for 48 hours using the combinations of the following reagents: aIgM (10ug/ml; Jackson Immune Research #115–006-075), aCD40 (1ug/ml; Biolegend #102901), R848 (1ug/ml; Invivogen # tlrl-r848), LPS (1ug/ml; Sigma # 437627), CpG ODN1826 (1ug/ml; Invivogen # tlrl-1826).