Peqstar

Manufactured by Avantor

Sourced in Germany

The PeqStar is a centrifuge product manufactured by Avantor. It is designed for general laboratory centrifugation applications.

Automatically generated - may contain errors

Lab products found in correlation

Superscript 3 one step rt pcr kit, by Thermo Fisher Scientific (1 mentions) Qiaamp viral rna mini, by Qiagen (1 mentions) Abi 3730 genetic analyzer, by Thermo Fisher Scientific (1 mentions) Master mix red, by Ampliqon (1 mentions) High pure pcr template preparation kit, by Roche (1 mentions)

Close spelling variants of this product

Thermal Cycler peqStar 2X PeqSTAR 2× PCR machine PeqSTAR 96 Universal Gradient PeqSTAR thermal cycler Peqstar thermo cycler PeqSTAR 96 Universal Thermocycler PeqSTAR 96 Universal Gradient thermocycler

5 protocols using peqstar

Chikungunya Virus Genome Identification

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA from samples presenting cytopathic effects was extracted using the commercial kit QIAamp viral RNA mini (QIAGEN, Valencia, CA, United States) according to the manufacturer’s instructions. Isolation was confirmed by reverse transcription real-time PCR (RT-PCR) using primers targeting the structural polyprotein (forward TATCCTGACCATCCGACCCT/reverse GGCTCTTGTCCTTGCACTCT) and Superscript III One-Step RT PCR Kit (Invitrogen Carlsbad, CA, United States), according to the manufacturer’s instructions. Amplification was performed in the PeqStar (PeqLab, Erlangen, Germany). PCR conditions were as follows: 60°C for 1 min, 50°C for 45 min, 94°C for 2 min followed by 45 cycles of 95°C for 15 s, 55°C for 30 s and 68°C for 60 s.
The resulting amplicons were sequenced in the ABI 3730 genetic analyzer (Applied Biosystems) following the manufacturer’s protocol. Raw sequence data were aligned, edited and assembled using the Assembler tool Bioedit Sequence Aligner Editor. The identity was confirmed by using the Basic Local Alignment Search Tool (Blast) and compared to other CHIKV sequences. Phylogenetic tree was constructed using MEGA 7 program. The sequences were deposited in GenBank under accession numbers MK910738 (BRA/RJ/1F), MK910739 (BRA/RJ/18), and MK910740 (BRA/RJ/23). For the antiviral activity assays the strain with deposit number MK910739 was used.

Cirne-Santos C.C., Barros C.D., Nogueira C.C., Azevedo R.C., Yamamoto K.A., Meira G.L., de Vasconcelos Z.F., Ratcliffe N.A., Teixeira V.L., Schmidt-Chanasit J., Ferreira D.F, & Paixão I.C. (2019). Inhibition by Marine Algae of Chikungunya Virus Isolated From Patients in a Recent Disease Outbreak in Rio de Janeiro. Frontiers in Microbiology, 10, 2426.

+ Open protocol

+ Expand

Genotyping P. aeruginosa Isolates

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two typing methods (ERIC-PCR and BOX-PCR) were used to genotype the P. aeruginosa clinical isolates, in order to study the bacterial genetic diversity within this complex group. The ERIC and BOX primer sequences (Macrogen, South Korea) were used in PCR to detect differences in the number and distribution of these repetitive sequences in the bacterial genome (Table 1) (14 (link), 15 (link)).
PCR amplification was performed in a final volume of 25 μL containing 3 μL of purified total DNA, 8 μL of PCR master mix (containing Taq polymerase, MgC1₂, dNTPs, and PCR buffer; Amplicon, Denmark), and 2.5 pM of each primer (Macrogen, South Korea). PCR was carried out in a thermal cycler apparatus (PeqStar; PeqLab, Germany) with an initial denaturation step at 95°C for 3 minutes, followed by 35 cycles including denaturation at 94°C for 1 minute, annealing (at 52°C for ERIC-PCR and at 48°C for BOX-PCR) for 1 minute and extension at 72°C for 2 minutes, with a final extension step at 72°C for 5 minutes.

Savari M., Rostami S., Ekrami A, & Bahador A. (2016). Characterization of Toxin-Antitoxin (TA) Systems in Pseudomonas aeruginosa Clinical Isolates in Iran. Jundishapur Journal of Microbiology, 9(1), e26627.

+ Open protocol

+ Expand

Genomic DNA Extraction and Parasite Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA of the samples was extracted using the following protocol. Briefly, 50 mg of each sample were frozen and thawed for three times (each for 10 min). DNA was extracted using High Pure PCR Template Preparation Kit (Roche, Germany) according to the manufacturer's instructions. Extracted DNA was stored at -20 °C for PCR amplification. The extracted DNA was used as template to detect eucoccidial parasites using conventional polymerase chain reaction (PCR). Fragments of nearly 900-bp from 18S ribosomal DNA genes were amplified using single PCR and forward (SarcoFext 5′-GGTGATTCATAGTAACCCAACG-3′) and reverse (SarcoRext 5′-GATTTCTCATAAGGTGCAGGAG-3′) primers (More et al., 2014 (link)). The PCR amplification was carried out with 20-μl reaction volumes, including 10 μl of 2× Master Mix RED (Ampliqon, Denmark) with 1.5 mM of MgCl₂, 1 μl of each primer at concentration of 10 pmol, 6.5 μl of sterile distilled water and 1.5 μl of the template DNA. The PCR reactions were amplified using thermal cycler (Peqlab peqSTAR, USA) with the following cycling conditions: initial hot start at 94 °C for 5 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 57 °C for 30 s and extension at 72 °C for 45 s. Final extension was carried out at 72 °C for 5 min. The PCR products were analyzed using electrophoresis on 1% agarose gel and UV visualization.

Ayazian Mavi S., Teimouri A., Mohebali M., Sharifi Yazdi M.K., Shojaee S., Rezaian M., Salimi M, & Keshavarz H. (2020). Sarcocystis infection in beef and industrial raw beef burgers from butcheries and retail stores: A molecular microscopic study. Heliyon, 6(6), e04171.

+ Open protocol

+ Expand

Amplification of TA Toxin-Antitoxin Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gene-specific internal primers (Macrogen, South Korea) were used to amplify the relBE, parDE, and higBA TA genes, and the intergenic primers (Macrogen, South Korea) were used to amplify the upstream and downstream of the flanking regions. The sequences of the primers used for this purpose are listed in Table 2 (17).
PCR amplification was performed in a final volume of 25 μL containing 3 μL of purified total DNA, 8 μL of PCR master mix (containing Taq polymerase, MgC1₂, dNTPs, and PCR buffer; Amplicon, Denmark), and 2.5 pM of each primer (Macrogen, South Korea). PCR was carried out in a thermal cycler apparatus (PeqStar; PeqLab, Germany) with an initial denaturation step at 94°C for 5 minutes, followed by 30 cycles including denaturation at 94°C for 1 minute, annealing at 52°C for 1 minute, and extension at 72°C for 1 minute, with a final extension step at 72°C for 5 minutes.

+ Open protocol

+ Expand

Polymorphic NQO1 Gene Analysis by PCR-RFLP

Check if the same lab product or an alternative is used in the 5 most similar protocols

The polymorphic NQO1 (rs1800566) gene was determined using the polymerase chain reaction (PCR)–restriction fragment length polymorphism (RFLP) method, as previously published [16 (link)]. Briefly, PCR was performed with the 25 μL reaction mixture containing 1 μL of DNA, 10 μM of each primer, 10 mM dNTPs, 25 mM of MgCl2, 5 U/μL of Taq polymerase, and 10× buffer. The amplification of the 273-bp fragment of the NQO1 gene was carried out in a thermocycler, PEQStar (PEQLAB Biotechnologie GmbH, Erlangen, Germany), using a pair of sense and antisense primers including 5′-AGTGG CATTC TGCAT TTCTGTG-3′ and 5′-GATGG ACTTG CCCAAG TGATG-3′. The initial denaturation step was performed at 95 °C for 5 min, followed by 33 cycles consisting of three steps: 95 °C for 28 s, 62 °C for 30 s, and 72 °C for 28 s. The final elongation was done at 72 °C for 5 min. The products were incubated with HinfI endonuclease (1U) for 16 h at 37 °C. After the digestion step, the PCR products and digested products were separated by 2% agarose gel electrophoresis and stained by ethidium bromide. The genotypes were determined by the pattern on the digested bands visualized in the ultraviolet gel documentation system (188 and 85 bp bands: CC genotype; 151 and 85 bp bands: TT genotype; 188, 151, and 85 bp bands: CT genotype).

Ahmadi N., Mandegary A., Jamshidzadeh A., Mohammadi-Sardoo M., Mohammadi-Sardo M., Salari E, & Pourgholi L. (2018). Hematological Abnormality, Oxidative Stress, and Genotoxicity Induction in the Greenhouse Pesticide Sprayers; Investigating the Role of NQO1 Gene Polymorphism. Toxics, 6(1), 13.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!