Pgemt easy ta vector

Manufactured by Promega

Sourced in United States

The pGEM-T Easy TA Vector is a plasmid vector designed for direct cloning of PCR products. The vector contains T7 and SP6 RNA polymerase promoters flanking a multiple cloning region within the alpha-peptide coding region of the enzyme beta-galactosidase. This allows for blue/white color screening of recombinant clones.

Automatically generated - may contain errors

Lab products found in correlation

Precision nanoscript2 reverse transcription kit, by Primerdesign (1 mentions) Taq polymerase, by New England Biolabs (1 mentions)

2 protocols using pgemt easy ta vector

ChIP-Cloning of ERRβ/ERα Targets

Check if the same lab product or an alternative is used in the 5 most similar protocols

MCF-7 cells were grown to 90% confluence in DMEM containing 10% FBS. Cells were crosslinked with 1% (v/v) formaldehyde, and crosslinking was stopped with 0.125 M glycine. Immunoprecipitation was performed as per Farnham's ChIP protocol. The primers used in the ERRβ/ERα ChIP are mentioned in the Table 3.
For ChIP cloning, purified ChIP elutes were ligated to a pGEMT-Easy TA vector from Promega (Madison, WI, USA) and transformed in E. coli strain JM109. Plasmids were isolated from individual colonies and digested with EcoR1/NotI for the presence of inserts.

Sengupta D., Bhargava D.K., Dixit A., Sahoo B.S., Biswas S., Biswas G, & Mishra S.K. (2014). ERRβ signalling through FST and BCAS2 inhibits cellular proliferation in breast cancer cells. British Journal of Cancer, 110(8), 2144-2158.

+ Open protocol

+ Expand

Xenopus Gdi3 Gene Cloning and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from stage 18 Xenopus tropicalis embryos (Guille, 1999) and used to generate a cDNA library (Precision nanoScript TM 2 Reverse Transcription kit from Primerdesign). Gdi3 gene specific primers (forward GTACTAGACTCTAGAATGGAGGAGATGTATGATGTC and reverse CATTCTTGGAAATCTGAGTTGTC) were used to amplify a 1332-bp product by extension with Q5 high fidelity Taq (New England Biolabs). 3' A overhangs were added to the amplified product by incubation with standard Taq polymerase (New England Biolabs) and the amplicon cloned into a pGEM-TEasy® TA vector (pGEM-TEasy, Promega). Recombinants were selected by restriction digest screening and the full sequence confirmed by Sanger dideoxy sequencing and primer walking (Source Bioscience).

Nazlamova L., Noble A., Schubert F.R., McGeehan J., Myers F., Guille M, & Scarlett G. (2017). A newly identified Rab-GDI paralogue has a role in neural development in amphibia. Gene, 599.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!