HK-2 cells (catalog number: CRL-2190) were obtained from American Type Culture Collection (ATCC) and were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA) at 37°C with 5% CO2 in a humidified atmosphere. Short hairpin RNA against MEG3 (sh-MEG3), miR-145-5p mimics/inhibitor, pcDNA3.1-RTKN vector, and respective controls (sh-NC, NC mimics/inhibitor, pcDNA3.1-NC) were constructed by GenePharma (Shanghai, China) and transfected into HK-2 cells using the Lipofectamine 2000 reagent (Invitrogen). Sequence for sh-MEG3 is GGACACATGAACGACTGAATT; sequence for miR-145-5p mimics is GUCCAGUUUUCCCAGGAAUCCCU; sequence for miR-145-5p inhibitor is AGGGAUUCCUGGGAAAACUGGAC; sequence for sh-c-MYC#1 is CAGTTGAAACACAAACTTGAA; and sequence for sh-c-MYC#2 is CCTGAGACAGATCAGCAACAA. At transfection for 48 h, cells were harvested for subsequent analyses.
Sh meg3
Manufactured by GenePharma
Sourced in China
Sh-MEG3 is a laboratory equipment product designed for gene expression analysis. It functions as a short hairpin RNA (shRNA) expression vector, which is used to induce RNA interference (RNAi) and effectively silence the expression of target genes. The Sh-MEG3 product provides a reliable tool for researchers to study gene function and regulatory mechanisms.
Automatically generated - may contain errors
Lab products found in correlation
Sh nc, by GenePharma (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Pcdna3.1 nc, by GenePharma (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Hk 2 cell, by American Type Culture Collection (1 mentions)
Lentiviral pu6 luc puro vector, by GenePharma (1 mentions)
Pcdna3.1 vector, by Thermo Fisher Scientific (1 mentions)
Pcdna meg3, by GenePharma (1 mentions)
3 protocols using sh meg3
1
Knockdown of lncRNA MEG3 in HK-2 cells
2
Establishing MEG3 Knockdown and Overexpression Models
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate the MEG3-knockdown model, short hairpin RNA (shRNA) sequences targeting MEG3 (sh-MEG3) and negative control (sh-NC) were purchased from Shanghai GenePharma Co., Ltd. After annealing, shRNA was integrated into lentiviral pU6-Luc-Puro vector (Shanghai GenePharma Co., Ltd.). To establish the MEG3 overexpression model, wild-type (o/e-MEG3) or mutant (o/e-NC) MEG3 fragment was amplified by PCR and subcloned into pcDNA3.1 vector (Invitrogen; Thermo Fisher Scientific, Inc.). Glioma cells were transfected with recombinant lentiviral vectors or the controls. Up- or downregulation of MEG3 was confirmed using RT-qPCR. The mimic or inhibitor of miR-96-5p and the corresponding negative control (NC) were purchased Shanghai GenePharma Co., Ltd., and were transfected into glioma cells using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). At 8-h post-transfection, the culture medium was replenished with fresh DMEM containing 10% FBS.
3
Modulating MEG3 and miR-21 in TNF-α-induced cell responses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GenePharma Co., Ltd. (Shanghai, China) designed and synthesized sh-MEG3, pcDNA-MEG3, vector+mimic NC, pcDNAMEG3 + mimic NC, pcDNA-MEG3 + miR-21 mimic, miR-21 inhibitor, miR-21 mimic, caspase-8 mRNA, and caspase-8 shRNA. After stimulation with TNF-α (10 ng/mL) for 24 h, cells were plated on 60-mm dishes and cultured for 24 h. Cell transfection and cotransfection were conducted with Lipofectamine 2000 (Invitrogen) according to instruction.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!