Nr4a1–/–, Nr4a1fl/fl, and Nr4a3–/– mice were previously described (6 (link), 20 (link), 23 (link)). Nr4a1fl/fl were previously obtained from Catherine Hedrick (La Jolla Institute for Immunology, La Jolla, California, USA) with permission from Pierre Chambon (University of Strasbourg, Strasbourg, France; ref. 6 (link)). Nr4a1–/– mice were obtained from The Jackson Laboratory, and this line is used throughout the manuscript exclusively as single germline knockout comparator (23 (link)). Nr4a3–/– mice were generated in our laboratory as previously described (20 (link)). CD8-cre and mb1-cre were obtained from The Jackson Laboratory (38 (link), 58 (link)). C57BL/6 mice were from The Jackson Laboratory, and CD45.1+ BoyJ mice were from Charles River Laboratories. To generate gDKO Nr4a1–/– Nr4a3–/– mice, we bred Nr4a3–/– and Nr4a1fl/fl mice with germline recombination of the loxp-flanked locus and confirmed loss of exon 2 by genomic DNA PCR and transcript quantitative PCR. All strains were fully backcrossed to C57BL/6 genetic background for at least 6 generations. Mice of both sexes were used for experiments between the ages of 3 and 10 weeks except for BM chimeras as described below.
Nr4a1 mice
Manufactured by Jackson ImmunoResearch
Sourced in United States
Nr4a1−/− mice are genetically modified animals that have a targeted deletion of the Nr4a1 gene, which encodes the nuclear receptor NR4A1. These mice are a useful tool for studying the physiological and pathological roles of NR4A1 in various biological processes.
Automatically generated - may contain errors
Lab products found in correlation
C57bl 6 mice, by Jackson ImmunoResearch (3 mentions)
Mb1 cre, by Jackson ImmunoResearch (2 mentions)
Cd8 cre, by Jackson ImmunoResearch (2 mentions)
Cd45.1 boyj mice, by Charles River Laboratories (2 mentions)
Fvb mice, by Jackson ImmunoResearch (1 mentions)
Wild type c57bl 6j mice, by Jackson ImmunoResearch (1 mentions)
C57bl 6j, by Jackson ImmunoResearch (1 mentions)
Ccr2 mice, by Jackson ImmunoResearch (1 mentions)
Csf2 mice, by Jackson ImmunoResearch (1 mentions)
8 protocols using nr4a1 mice
1
Genetic Mouse Models for Nr4a1 and Nr4a3
2
Microglia-specific Nr4a1 Knockout Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nr4a1-/- mice were purchased from Jackson Laboratory. Mice carrying Nr4a1-floxed alleles (Nr4a1fl/fl) were provided by GemPharmatech, and Tmem119-CreERT2 mice were provided by Shanghai Model Organisms. Microglia-specific Nr4a1 conditional knockout (Tmem119-CreERT2; Nr4a1fl/fl) mice were generated by breeding Tmem119-CreERT2 mice with Nr4a1fl/fl mice. Age- and gender-matched Nr4a1fl/fl littermates served as WT controls for experiments involving Tmem119-CreERT2; Nr4a1fl/fl mice. Nr4a1-/-, Nr4a1fl/fl, and Tmem119-CreERT2; Nr4a1fl/fl mice were on the C57BL/6 background. All experimental mice were fed a standard rodent diet and kept on a 12-h light and 12-h dark cycle. For genotyping, 2 primers were used (Cre_1, TGGCCCAGCTCCTCCTCATCCTCT; Cre_2, TCTGGCCTGGTCCCCTTCTGCTCT) for Tmem119-CreERT2, which gave 640-bp band; 2 primer pairs were used (Fl _1, AGCCTCTGGTTCTCCACAGA; Fl_2, GGGAAGATCCCAGAACCCAA) for Nr4a1-floxed alleles, which gave a 271 bp for WT control and a 360 bp for Nr4a1-floxed alleles. Tmem119-CreERT2; Nr4a1fl/fl and Nr4a1fl/fl mice were intraperitoneally injected with tamoxifen (dissolved in corn oil at 20 mg/ml) (75 mg/kg) for 5 consecutive days to induce Cre activity 3 weeks prior to MCAO.
3
Genetically Modified Sickle Cell Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HbSS-Townes sickle mice (homozygous for βS) and HbAA-Townes control mice (homozygous for βA) were obtained by breeding HbAS-Townes mice (013071, The Jackson Laboratory). C57BL/6J WT mice (000664), Tlr4–/– mice (029015), Ifnar1–/– mice (028288), Nr4a1–/– mice (006187), and FVB mice (001800) were acquired from The Jackson Laboratory. Vav1-cre+Nrf2floxp+/+(Vav1creNrf2+/+) mice, deficient in Nrf2 in the hematopoietic lineage and ECs, were obtained by crossing Vav1-cre mice (008610) with Nrf2floxp mice (025433), which were obtained from Larry Luchsinger (New York Blood Center) (72 (link)). All mice were bred in house, fed a standard rodent chow diet, and housed in microisolator cages in a special pathogen–free facility.
4
Experimental Mice Strains for Immunology
5
Murine Immunology Research Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6J wild-type mice (000664), B6.SJL-Ptprca Pepcb/BoyJ (002014) CD45.1 mice, and Nr4a1−/− mice on a congenic C57BL/6J background (006187) were from The Jackson Laboratory. Mice were fed a standard rodent chow diet and were housed in microisolator cages in a pathogen-free facility. The NR4A1-GFP reporter mice were generated as described, were a kind gift of Dr Kristin A. Hogquist (University of Minnesota), and are now available from The Jackson Laboratory (016617). All experiments followed guidelines of the La Jolla Institute for Allergy and Immunology Animal Care and Use Committee, and approval for use of rodents was obtained from the La Jolla Institute for Allergy and Immunology according to criteria outlined in the Guide for the Care and Use of Laboratory Animals from the National Institutes of Health. Mice were euthanized by CO2 inhalation.
6
Genetic Mice Models for Immune Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6 mice (#000664), LysM-eGFP mice, Cx3cr1GFP/GFP (CX3CR1-deficient) mice (#005582), and Nr4a1−/− mice (#006187) were obtained from The Jackson Laboratory. Generation of Ccr2RFP/RFP (CCR2-deficient) mice have been previously described37 (link). Cx3cr1GFP/+Ccr2RFP/+ mice were generated by crossing Cx3cr1GFP/GFPCcr2RFP/RFP mice with C57BL/6 mice37 (link). All mice were on a C57BL/6 background. Animals were maintained in a specific pathogen-free environment with ad libitum access to food and water. Mice were housed under standardized conditions of temperature (21–22 °C) and illumination (12/12 h light/dark cycle). Mice of 8–12 weeks of age were used for experiments. Mice were gender-matched for experiments and experimental/control mice were bred separately. Mice were euthanized by cervical dislocation after imaging or for tissue sampling. All experiments were approved by the Kumamoto University Ethics Review Committee for Animal Experimentation and were performed according to guidelines of the Institutional Animal Committee of Kumamoto University.
7
Transgenic Mouse Strains for Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6 mice were purchased from the National Cancer Institute (Frederick, MD) for use as wild-type mice and were housed in the animal facilities at the University of Maryland, College Park prior to use in experiments. CCR2−/− mice (Strain #: 004999), Nr4a1−/− mice (Strain #: 006187), and CSF2−/− mice (Strain #: 026812), all in the C57BL/6 background were purchased from The Jackson Laboratory (Bar Harbor, ME, USA), and bred in-house. All mice were maintained in specific-pathogen-free conditions in individually ventilated cages with a standard 12 h light/dark cycle. For experiments, age- and sex-matched, male or female 6- to 8-week-old mice were used. The study protocol was approved by the Institutional Animal Care and Use Committee (IACUC) at the University of Maryland, College Park. All animal studies were conducted in accordance with the National Institutes of Health guidelines.
8
Generating Nr4a1 and Nr4a3 Knockout Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice. Nr4a1 -/-, Nr4a1 fl/fl , and Nr4a3 -/-mice were previously described (14, 27, 30) .
Nr4a1 fl/fl were previously obtained from Catherine Hedrick (La Jolla Institute for Immunology) with permission from Pierre Chambon (University of Strasbourg) (14) .
Nr4a1 -/-mice were obtained from The Jackson Laboratory and this line is used throughout the manuscript exclusively as single germline knockout comparator (30), Nr4a3 -/-mice were generated in our laboratory as previously described (27) . CD8-cre and mb1-cre were obtained from The Jackson Laboratory (46, 77) . C57BL/6 mice were from The Jackson Laboratory and CD45.1 + BoyJ mice were from Charles River Laboratories. To generate germline DKO Nr4a1 -/-Nr4a3 -/-mice, we bred Nr4a3 -/-and Nr4a1 fl/fl mice with germline recombination of the loxp-flanked locus, and confirmed loss of exon 2 both by genomic DNA PCR and transcript qPCR. All strains were fully backcrossed to C57BL/6 genetic background for at least 6 generations. Mice of both sexes were used for experiments between the ages of 3 and 10 weeks except for BM chimeras as described below. All mice were housed in a specific pathogen-free facility at UCSF according to the University and National Institutes of Health guidelines.
Nr4a1 fl/fl were previously obtained from Catherine Hedrick (La Jolla Institute for Immunology) with permission from Pierre Chambon (University of Strasbourg) (14) .
Nr4a1 -/-mice were obtained from The Jackson Laboratory and this line is used throughout the manuscript exclusively as single germline knockout comparator (30), Nr4a3 -/-mice were generated in our laboratory as previously described (27) . CD8-cre and mb1-cre were obtained from The Jackson Laboratory (46, 77) . C57BL/6 mice were from The Jackson Laboratory and CD45.1 + BoyJ mice were from Charles River Laboratories. To generate germline DKO Nr4a1 -/-Nr4a3 -/-mice, we bred Nr4a3 -/-and Nr4a1 fl/fl mice with germline recombination of the loxp-flanked locus, and confirmed loss of exon 2 both by genomic DNA PCR and transcript qPCR. All strains were fully backcrossed to C57BL/6 genetic background for at least 6 generations. Mice of both sexes were used for experiments between the ages of 3 and 10 weeks except for BM chimeras as described below. All mice were housed in a specific pathogen-free facility at UCSF according to the University and National Institutes of Health guidelines.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!