Abi 7500 real time pcr system

Animals were decapitated, and the lumbar enlargement of the spinal cord was extracted by sterilized instruments 30 minutes after DNFB or acetone painting. The total RNA was extracted by an RNA Extraction Kit (Takara, Kyota, Japan). The isolated RNA was reverse-transcribed to synthesize the first-strand cDNA using a cDNA synthesis kit (Thermo Scientific, Waltham, MA). Sequences for all forward and reverse primers were as follows: forward and reverse primers of H1R were GGGTCCCTCCCTACCTTTTTA and GCGTGTGACTGTTTCCCTTTC; and forward and reverse primers of H4R were GGAAGCTAGCCAGGTCACTG and TTCCGTTCTGGGGTAAGTTG. An ABI 7500 Real-Time PCR System and SYBR Green I (Tiangen, Beijing, China) were used in the PCR. Real-time PCR liquid was prepared and reaction conditions were set following kit instructions. Glyceraldehyde-3-phosphate dehydrogenase served as an internal control. The melting curve was used to evaluate the reliability of the PCR results. Threshold cycle (CT) values (the inflection point of the amplification curve) were determined, and the relative expression of target genes was calculated using the 2 ÀDD Ct method.

P. savastanoi pv. phaseolicola strains were cultured at 28°C in KB and were then transformed to MM medium at OD 600 = 0.4 to 0.6. After inducing for 6 h, the bacteria were harvested by centrifugation at 6,000 rpm for 4 min. The RNA was purified by the Purification Kit (Sangon Biotech). The cDNA synthesis was performed by using a cDNA synthesis kit (Takara) with 1.2 µg of total RNA in each reaction; 100 ng of each sample was added into each well. Each reaction was performed in triplicate in 20-µl reaction volumes, with 16S rRNA as a control. For each reaction, 200 nM primers were used for RT-qPCR. The reactions were run at 37°C for 15 min, 85°C, for 5 s, and 4°C to save. Next, RT-qPCR was conducted under SYBR Green (Tiangen Biotech) instruction using the ABI 7500 Real-Time PCR System. The reaction includes 15 min at 95°C and 40 cycles of 10 s at 95°C and 32 s at 60°C. The fold change represents relative expression level of mRNA and can be calculated by the values of 2 _ DDCt .