Realq plus master mix for probe

Real-time PCR was performed using specific primers and probe sequences targeting the IS1111 element of C. burnetii. Real-time PCR reactions were performed using the following reaction mixture: 10 μL of 2x RealQ Plus Master Mix for Probe (Ampliqon, Denmark), 900 nM forward primer (AAAACGGATAAAAAGAGTCTGTGGTT), 900 nM reverse primer (CCACACAAGCGCGATTCAT), 200 nM probe (6-FAM-AAAGCACTCATTGAGCGCCGCG-TAMRA) and 4 μL of DNA template [10 (link)]. Real-time PCR was performed on the Corbett 6000 Rotor-Gene system (Corbett, Victoria, Australia), with a final volume of 20 μL for each reaction. The PCR amplification program was 10 minutes at 95°C, followed by 45 cycles of 15 s at 94°C and 60 s at 60°C. DNA of the Nine Mile strain (RSA 493), was used as a positive control and double distilled water was used as a negative control. Results were generated using Rotor-Gene^® Q 2.3.5 software (QIAGEN). Samples showing cycle threshold (Ct) values of 36 or lower for C. burnetii IS1111 qPCR assays were considered positive [10 (link)]. The positive samples were tested three times by RT-PCR. Also, PCR products of positive samples were visualized by 2% agarose gel electrophoresis (70 bp). Finally, the samples that had a first positive test and the next two tests were positive and also had the acceptable amplicon size in the agarose gel electrophoresis were considered as true positive.

IS1111 element of C. burnetii was targeted by qPCR using specific primers ([forward: AAAACGGATAAAAAGAGTCTGTGGTT] and [reverse: CCACACAAGCGCGATTCAT]) and probe (6-FAM-AAAGCACTCATTGAGCGCCGCG-TAMRA) sequences [35 (link)]. Sequences of used primer/probe, qPCR mixture, and cycling conditions for qPCR performed during this study are presented in Supplementary Information file 1. Briefly, the final volume of each qPCR reaction was 20 μl, contained 10 μl of 2X Real Q Plus Master Mix for Probe (Ampliqon, Denmark), 1 μl of a mixture of probe (with the final concentration of 200 nM), and forward and reverse primers (with the final concentration of 900 nM), 4 μl of extracted DNA, and 5 μl of double-distilled water (DDW). Amplifications were performed on the Corbett 6000 Rotor-Gene system (Corbett, Victoria, Australia). The qPCR program was 10 min at 95 °C, followed by 45 cycles of 15 s at 94 °C and 60 s at 60 °C. DDW and purified DNA of the Nine Mile strain (RSA 493) were used as negative and positive controls, respectively. qPCR results were analyzed using a Rotor-Gene® Q 2.3.5 software (QIAGEN), and samples were considered positive when showing cycle threshold (Ct) values of 40 or lower.

Real-time PCR (TaqMan Real-time PCR) was performed using primers (forward; AAAACGGATAAAAAGAGTCTGTGGTT, reverse; CCACACAAGCGCGATTCAT) and probe (6-FAM-AAAGCACTCATTGAGCGCCGCG-TAMRA) targeting IS1111a element of C. burnetii [10 (link)]. Each real-time PCR reaction (final volume 20 μL) included 900 nM of each forward and reverse primers, 200 nM probe, 10 μL of 2x RealQ Plus Master Mix for Probe (Ampliqon, Denmark), and 4 μL of extracted DNA. The real-time PCR program was 95°C for 10 minutes, followed by 94°C for 15 seconds and 60°C for 60 seconds (45 cycles) in a Corbett 6000 Rotor-Gene system (Corbett, Victoria, Australia). DNA of Nine Mile strain (Nine Mile Phase I/RSA 493) was used as a positive control, and double distilled water was used as a negative control. Results were analyzed using Rotor-Gene® Q 2.3.5 software (QIAGEN). Samples were considered positive in real-time PCR analysis, if their cycle threshold (Ct) values were 38 or lower.