Leaf total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). RNA was quanti ed spectrophotometrically, and the quality was evaluated by agarose gel electrophoresis. Synthesis of cDNA was performed using a Power cDNA Synthesis Kit (Intron Biotechnology Inc., South Korea). Quantitative real-time polymerase chain reaction (qPCR) was performed using a CFX 96 Real-Time system (Bio-Rad, Richmond, CA, USA) with SYBR-green uorescence, and the results were analyzed using the ΔΔCT method. Gene-speci c primers (Table S1) for qPCR were used to evaluate the genes' activity under progressive drought conditions. The thermal cycle employed was 95°C for 5 min and 40 cycles of 95°C for 15 s, 55°C for 15 s, and 72°C for 30 s. All experiments were conducted with three biological replicates, and the relative transcript levels were standardized using Actin as the internal control.
Power cdna synthesis kit
Manufactured by iNtRON Biotechnology
Sourced in United States
The Power cDNA Synthesis Kit is a laboratory tool designed for the efficient synthesis of complementary DNA (cDNA) from RNA templates. The kit provides the necessary reagents and protocols to convert RNA samples into cDNA, which can be used in various downstream applications, such as gene expression analysis, cloning, or real-time PCR.
Automatically generated - may contain errors
Lab products found in correlation
Purelink rna mini kit, by Thermo Fisher Scientific (8 mentions)
Tri reagent, by Thermo Fisher Scientific (6 mentions)
Geneallr riboex total rna extraction kit, by GeneAll (5 mentions)
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Power sybr green master mix, by Thermo Fisher Scientific (5 mentions)
Cfx96 real time system, by Bio-Rad (3 mentions)
Genejet rna purification kit, by Thermo Fisher Scientific (3 mentions)
Rotor gene q 5plex machine, by Qiagen (3 mentions)
Sybr premix ex taq, by Takara Bio (3 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (3 mentions)
Stepone real time pcr system, by Thermo Fisher Scientific (3 mentions)
Rotor gene sybr green pcr kit, by Qiagen (2 mentions)
Rotor gene q 2plex hrm, by Qiagen (2 mentions)
Spectradrop micro volume microplate, by Molecular Devices (2 mentions)
Nanophotometer, by Implen (2 mentions)
Eco real time pcr system, by Illumina (2 mentions)
Qiazol lysis reagent, by Qiagen (2 mentions)
Rotor gene q 5plex, by Qiagen (2 mentions)
Sybr premix ex taq 2, by Takara Bio (2 mentions)
Spectramax abs plus microplate reader, by Molecular Devices (2 mentions)
41 protocols using power cdna synthesis kit
1
Drought Responsive Gene Expression Analysis
2
RNA Extraction and cDNA Synthesis from HUVECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HUVECs were seeded at a density of 2 × 105 cells per well and incubated for 24 h. Culture medium without FBS was added, and ginseng berry extract at various concentrations (20, 100, and 500 μg/ml) was added. TNF-α (10 ng/ml) was added to each group (except normal cell group) and incubated for 24 h. Cells were washed with 1× DPBS and treated with easy-BLUETM (1 ml) of the Total RNA Extraction Kit (Intron Biotechnology, Sungnam, Gyeonggi-do, South Korea). Cell lysates were collected, 200 μl of chloroform was added, and centrifuged at 10,000 ×g (4˚C, 10 min). Supernatants were collected, iso-propanol (500 μl) was added, and the mixture was kept for standing for 10 min at room temperature. The mixed solution was centrifuged at 7,500 ×g (4˚C, 10 min), and the supernatants were discarded. Pellets were washed with 75% ethanol and centrifuged at 7,500 ×g (4˚C, 5 min) twice. Pellets were dissolved with distilled water and treated with DEPC. Extraction of total RNA from A7r5 cells, which were co-cultured with HUVECs, was performed following the same procedure.
cDNA synthesis was performed with Power cDNA Synthesis Kit (Intron Biotechnology), according to the manual in the kit. Total RNA (1 μg) was used to synthesize cDNA, which was used to perform reverse transcription-polymerase chain reaction.
cDNA synthesis was performed with Power cDNA Synthesis Kit (Intron Biotechnology), according to the manual in the kit. Total RNA (1 μg) was used to synthesize cDNA, which was used to perform reverse transcription-polymerase chain reaction.
3
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the qRT-PCR analysis, RNA (1 μg) isolated from the WK strains grown in the MB and MBCG media was converted into cDNA using a Power cDNA Synthesis Kit (iNtRON Biotechnology, Seoul, Korea). The cDNA synthesis process was started at 42 °C for 60 min, followed by incubation at 95 °C for 5 min to terminate the cDNA synthesis reaction. The 18S (18S ribosomal protein) gene expression of the WK strains served as the housekeeping gene for normalization of qRT-PCR [20 (link)]. After dilution of the cDNA, qRT-PCR was performed with Rotor-Gene Q 2plex HRM (Qiagen, Hilden, Germany) using the Rotor-Gene SYBR Green PCR Kit (Qiagen, Hilden, Germany). fusA (5′-TGGCAGAGGAGAAGTACAAC-3′), ssb1 (5′-GCACGTCGTTACACCTTATC-3′), and clpP (5′-ACGTGGAGAGCGTTCATA-3′) were synthesized by Bioneer (Daejeon, Korea). The PCR reaction condition was as follows: denaturation at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 10 s and annealing at 72 °C for 15 s. The 1-min real-time PCR experiments were conducted with three replications of each gene-specific primer for the 2D electrophoresis selected proteins. The relative gene expression was calculated using the 2−ΔΔCt method compared to the MB sample with the MBCG condition as the control [21 (link)].
4
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRI Reagent™ solution (Invitrogen, Waltham, MA, USA) and quantified using a SpectraDrop™ microvolume microplate (Molecular Devices). The ratio of the absorbance at 260 nm and 280 nm (A260:A280) and the absorbance at 260 nm and 230 nm (A260:A230) of the extracted RNA was in the acceptable range (1.8–2.0). The first strand of cDNA was synthesized from 1 µg of total RNA using a power cDNA synthesis kit (iNtRON Biotechnology, Inc., Gyeonggi, Republic of Korea).
5
Salinity Stress Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Plant Total RNA kit (Invitrogen, USA) was used for the extraction of total RNA from leaf samples, according to the manufacturer's instructions. The nanophotometer (Implen Inc., Westlake) was used to ensure the quality and quantity of RNA while the ethidium-bromide stain analyses using agarose gel electrophoresis was used to check the purity of total RNA. The Power cDNA synthesis kit (Intron Biotechnology Inc., USA) was used to reverse transcribe DNA free total RNA into cDNA.
To evaluate the expression pattern of salinity stress candidate genes, antioxidant-related genes, osmolytes-biosynthesis-related, photosystemrelated and ABA-related genes used in the study (Table 1), the CFX 96 Real-Time system (Bio-Rad, Richmond, CA, USA) with SYBR-green fluorescence was used and analyses of the results were done by using the ΔΔCT method. The conditions for the thermal cycle was 95°C for 5min and 40 cycles of 95°C for 15s, 55°C for 15s and 72°C for 30s. The experiment was triplicated, using the Actin as an internal control for standardizing the relative transcript levels.
To evaluate the expression pattern of salinity stress candidate genes, antioxidant-related genes, osmolytes-biosynthesis-related, photosystemrelated and ABA-related genes used in the study (Table 1), the CFX 96 Real-Time system (Bio-Rad, Richmond, CA, USA) with SYBR-green fluorescence was used and analyses of the results were done by using the ΔΔCT method. The conditions for the thermal cycle was 95°C for 5min and 40 cycles of 95°C for 15s, 55°C for 15s and 72°C for 30s. The experiment was triplicated, using the Actin as an internal control for standardizing the relative transcript levels.
6
Isolation of Goat Mesenchymal Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We purchased Dulbecco’s modified Eagle’s medium (DMEM), penicillin and streptomycin (PS) from Welgene (Dalseogu, Daegu, Korea), fetal bovine serum (FBS) from HyClone Laboratories, Inc (Logan, UT, USA), horse serum (HS) from Gibco Technologies Inc (Grand Island, NY, USA), Power cDNA synthesis kit from Intron biotechnology and primers from Macrogen. The RA, linolenic acid, pigskin gelatin, dexamethasone, insulin, biotin, ascorbic acid, pantothenic acid, ascorbic acid and protease (Pronase [P5147]) were obtained from Sigma Aldrich (Seoul, Korea). Xylazine and Ketamine were obtained from Yuhan Co., Seoul, Korea. GMSC’s were isolated from 90 days old goats.
7
Evaluating Biofilm-Related Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The effect of ZnO NPs on the biofilm-related genes (fnbA, fnbB, ebpS, icaC) [43 (link)] was determined by qRT-PCR, and the utilized housekeeping gene was 16S rRNA. The sequences of the primers are presented in Table S1 . After extracting total RNA with the GeneJET RNA purification kit (Thermo Scientific, Waltham, MA, USA) described by the manufacturer, cDNA was formed using a power cDNA synthesis kit (iNtRON Biotechnology, Seongnam, Korea). Then, cDNA was amplified by Power SYBR® Green master mix (Thermo Scientific, Waltham, MA, USA) in a Rotor-Gene Q 5plex machine (Qiagen, Hilden, Germany). We used the 2−ΔΔCt method for the calculation of the relative gene expression. The expression of the genes in the isolates before treatment was 1 [44 (link)].
8
Quantitative Analysis of Stress-Responsive Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Data were subjected to one-way ANOVA. The mean values for ten replicate samples were compared using Duncan's multiple range test. Differences were considered significant at P ≤ 0.05.
Quantitative RT-PCR analysis Seven selected mutant lines were grown in medium containing 170 mM NaCl for two weeks, and total RNA was isolated using TRIzol reagent according to the manufacturer's protocol (Gibco BRL, Cleveland, OH, USA). Next, 1 μg of total RNA was used as a template for reverse transcription using a Power cDNA Synthesis Kit (Intron Biotechnology, Sungnam, Korea) for 60 min at 42 °C with 1 μg oligo(dT)15 primers. The synthesized cDNAs were used as templates for quantitative RT-PCR, which was performed on the Eco Real-Time PCR system (Illumina, San Diego, CA, USA) using SYBR Premix Ex Taq (Takara). The PCR thermal cycle conditions were 95 °C for 10 min, followed by 45 cycles of 95 °C for 10 sec and 60 °C for 30 sec. The primer sequences are listed in Table 1. The OsACT1 (Os03g0718100) gene was used as the internal control (Hwang et al., 2014b) .
Quantitative RT-PCR analysis Seven selected mutant lines were grown in medium containing 170 mM NaCl for two weeks, and total RNA was isolated using TRIzol reagent according to the manufacturer's protocol (Gibco BRL, Cleveland, OH, USA). Next, 1 μg of total RNA was used as a template for reverse transcription using a Power cDNA Synthesis Kit (Intron Biotechnology, Sungnam, Korea) for 60 min at 42 °C with 1 μg oligo(dT)15 primers. The synthesized cDNAs were used as templates for quantitative RT-PCR, which was performed on the Eco Real-Time PCR system (Illumina, San Diego, CA, USA) using SYBR Premix Ex Taq (Takara). The PCR thermal cycle conditions were 95 °C for 10 min, followed by 45 cycles of 95 °C for 10 sec and 60 °C for 30 sec. The primer sequences are listed in Table 1. The OsACT1 (Os03g0718100) gene was used as the internal control (Hwang et al., 2014b) .
9
Quantifying Cartilage mRNA Expressions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine mRNA levels of bone morphogenetic protein 2 (BMP-2), matrix metalloproteinase 13 (MMP-13), COX-2, Col2A, and transforming growth factor beta (TGF-β), total RNA was extracted from cartilage tissue of the experimental groups. Total cDNA was synthesized from 1 μg of total RNA using a power cDNA synthesis kit (iNtRON biotechnology). The primer sequences used in this experiment are given in Table 1 .Table 1
Nucleic acid sequences of the primers used for RT-PCR.
| Target | Sequence (5′ to 3′) | |
|---|---|---|
| BMP2 | Forward | TCCTCAGCGAGTTTGAGTTGAG |
| MMP13 | Forward | CTTCTGGCACACGCTTTTCC |
| Col2A | Forward | GAGCAGCAAGAGCAAGGAGA |
| COX-2 | Forward | ACAATAGACGCCCAAGAAGTAGA |
| TGF-β | Forward | GCTGAACCAAGGAGACGGAA |
| β-Actin | Forward | AACCGTGAAAAGATGACCCAGA |
10
RNA Extraction and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from organ tissues (leaves, roots, stems, seeds, and flowers) and the extract was treated with TRIzol reagent (Invitrogen, Carlsbad, CA, USA). A Power cDNA synthesis kit (iNtRON Biotechnology, Korea) was used to synthesize first-strand circular DNA (cDNA) from 1 μg total RNA according to the manufacturer’s instructions. Polymerase chain reaction (PCR) was used to confirm the specificity of gene-specific primers designed using Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi? LINK_LOC=BlastHome) (Additional file 6 : Table S3). Diluted cDNAs were used as templates for semi-quantitative real-time (RT)-PCR analysis. Semi-qRT-PCR was performed as follows: initial denaturation at 95 °C for 5 min, followed by 35 cycles of 1 min at 95 °C, 30 s at 58 °C, 1 min at 72 °C, and a final elongation step at 72 °C for 5 min. Quantitative real-time PCR (qRT-PCR) was performed using EvaGreen 2X qPCR Mastermix (ABM, Vancouver, BC, Canada) on a CFX-96 RT-PCR systems (Bio-Rad Laboratories Inc., Hercules, CA, USA) with three independent replicates. Gene expression was calculated as the fold change using the 2−ΔΔCT method [50 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!