As previously described by Voorham et al[12 (link)], the paraffin-embedded sections were incubated for five days in ATL lysis buffer (QIAmp DNA Micro Kit, Qiagen, Beijing, China). Proteinase K (10 μL from a 20 ng/μL solution) was added daily. DNA isolation was performed using a column-based technique (QIAmp DNA Micro Kit, Qiagen). A Beckman UV-vis spectrophotometer (Beckman, CA, United States) was used to measure DNA concentrations and purities.
Qiamp dna micro kit
Manufactured by Qiagen
Sourced in Germany, United States, Netherlands, Spain, United Kingdom
The QIAamp DNA Micro Kit is a DNA extraction and purification kit designed for isolating genomic DNA from small sample sizes. The kit uses a silica-based membrane technology to capture and purify DNA, which can then be used for various downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000, by Thermo Fisher Scientific (8 mentions)
Aligner software version 3, by CodonCode (6 mentions)
Qiamp dna mini kit, by Qiagen (4 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Quant it picogreen dsdna assay kit, by Thermo Fisher Scientific (4 mentions)
Dneasy blood tissue kit, by Qiagen (3 mentions)
Qiaamp dna mini kit, by Qiagen (3 mentions)
Taq dna polymerase, by Qiagen (3 mentions)
Aligner software, by CodonCode (3 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (2 mentions)
Dna micro kit, by Qiagen (2 mentions)
Typhoon fla 9500 phosphorimager, by GE Healthcare (2 mentions)
Pwo polymerase, by Roche (2 mentions)
Ion torrent pgm, by Thermo Fisher Scientific (2 mentions)
Hiseq 2000, by Illumina (2 mentions)
Genomic tip 20 g, by Qiagen (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Qubit dsdna br assay kit, by Thermo Fisher Scientific (2 mentions)
Miseq platform, by Illumina (2 mentions)
Abi 3730 genetic analyzer, by Thermo Fisher Scientific (2 mentions)
125 protocols using qiamp dna micro kit
1
DNA Extraction from Paraffin-Embedded Tissues
2
Analysis of Heterozygous Brca1 Loss in Rat Tumors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA for the loss of heterozygosity (LOH) analysis was obtained from cryosections (1–3 mm2) of tumors and normal kidney tissues of Brca1L63X/+ rats with a laser microdissection system (MMI CellCut; Molecular Machines & Industries) and QIAamp DNA Micro Kits (Qiagen) and used for allele‐specific qPCR as mentioned above. Genomic DNA for target sequencing was extracted from mammary carcinomas developed in the Brca1L63X/+ rats in the untreated (n = 10), irradiated (3 weeks of age, n = 11), and MNU groups (dose 25 mg/kg, n = 3; 50 mg/kg, n = 8) or from normal mammary glands using Qiagen AllPrep DNA/RNA Micro Kits (Qiagen). Extracted DNA was then treated with ribonuclease A and purified using QIAmp DNA Micro Kits (Qiagen). DNA was quantified using a Qubit fluorometer (Life Technologies) and submitted to Azenta Japan for target sequencing with the DNBSEQ platform (MGI Tech). Capture probes were designed to target the rat Brca1 gene (chr10:86,418,468–86,477,304 on the mRatBN7.2/rn7 assembly; Twist Biosciences). Somatic single‐nucleotide variants and insertion/deletions in tumors were called with the VarScan 2 software (version 2.4.4).23 A false‐positive filter was then applied to remove sequencing‐ and alignment‐related artifacts. Variants were annotated and the effect on coding sequences predicted using the SnpEff software (version 4.3).24
3
DNA Extraction and Quantification
4
Telomere Length Determination Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pooled oocytes (50 oocytes per sample) were collected for DNA extraction. DNA was extracted using QIAmp DNA micro Kit (Qiagen, Valencia) according to the manufacturer’s instructions. Real-time PCR was performed with SYBR Green using ABI StepOne Plus PCR system (Applied Biosystems). The telomere signal was normalized to the signal from the single-copy gene to generate a T/S ratio indicative of relative telomere length. The related primer sequences are listed in the Supplementary Table 1 .
5
Quantifying HIV DNA in CD4 T cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For measurement of HIV DNA in bulk CD4 T cells, CD4 T cells were enriched from cryopreserved PBMCs as above or using Dynabeads Untouched Human CD4 T Cell Enrichment kit (Invitrogen). DNA was extracted from PBMCs or enriched CD4 T cells using QIAamp Blood Mini Kit (Qiagen) and sorted CD4 T cell subsets (QIAmp DNA Micro Kit or Mini Kit) for use as input for qPCR assays. Copies of HIV-1 DNA were quantified and normalized to number of input cells (as determined by albumin PCR), by a previously described assay (41 (link), 42 (link)) with both qPCR assays performed in triplicate. For sorted populations PCR reactions for both albumin and total HIV were performed in triplicate for the CD32- population and in duplicate for the remaining populations, except where otherwise noted. Negative sample wells were replaced with zeros when averaging replicate values.
6
Genotyping Retinal CFH Y402H Variant
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from graded donor retinal tissue using QIAmp DNA Micro kit (Qiagen; Hilden, Germany). DNA was quantified using Quant-iT PicoGreen dsDNA assay kit (ThermoFisher; Waltham, MA, USA). Samples were genotyped for the Complement Factor H (CFH) variant Y402H using allele-specific primers designed for the single nucleotide polymorphism (SNP) rs1061170. CFH-Y402H-F: TGAGGGTTTCTTCTTGAAAATCA, CFH-Y402H-R: CCATTGGTAAAACAAGGTGACA. PCR product purified with Gel PCR DNA fragments extraction kit (IBI Scientific; Shelton, CT, USA) was submitted for classic Sanger Sequencing (U of MN Genomics Core). Base calling was manually inspected using Sequence Scanner 2 software (Applied Biosystems; Foster City, CA, USA).
7
Profiling B Cell Repertoire Diversity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice (n = 3 per group) were immunized with TLR7–alum- or TLR7-NP-adjuvanted recombinant HA (H1 HA PR8) as described above. GC B cells were sorted from draining lymph nodes of immunized mice 14 days post-immunization and DNA was extracted using a QIAmp DNA Micro Kit (Qiagen). Sequencing of mouse IgH chains was performed using the immunoSEQ Assay (Adaptive Biotechnologies). The diversity index iChao1 is calculated using the Adaptive Biotechnologies Immuoseq Analyzer software. iChao1 is a non-parametric estimator of the lower bound of the total number of unique templates within an individual’s repertoire. The lower bound is the minimum number of unique templates predicted to be within an individual’s repertoire, with a 95% confidence interval58 (link)–60 .
8
Reduced Representation Bisulfite Sequencing of DRG
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from DRG of 10 days after chemotherapeutic drug group or vehicle group using the QIAmp DNA Micro Kit (Qiagen, 56 304). Reduced representation bisulfite sequencing (RRBS) sequencing libraries were prepared as describe previously (Gu et al., 2011 (link)). Briefly, a total amount of 5.2 μg genomic DNA spiked with 26 ng lambda DNA was fragmented by sonication to 200 to 300 bp with Covaris S220 followed by end repair and adenylation. Cytosine-methylated barcodes were ligated to sonicated DNA as per manufacturer’s instructions. Furthermore, these DNA fragments were treated twice with bisulfite using an EZ DNA Methylation-Gold Kit (Zymo Research) before the resulting single-strand DNA fragments were PCR amplificated using KAPA HiFi HotStart Uracil + ReadyMix (2X). Qubit 2.0 Fluorometer (Life Technologies, CA) and qPCR were used to quantify library concentration, and the insert size was assayed on an Agilent Bioanalyzer 2100 system. Then the library preparations were sequenced on an Illumina Hiseq 2500/4000 or Novaseq platform, and 125-bp/150-bp paired-end reads were generated. Finally, image analysis and base calling were performed with Illumina CASAVA pipeline, and 125-bp/150-bp paired-end reads were generated.
9
Quantifying Genome Editing Efficiency
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from cells using Qiamp DNA microkit (Qiagen), according to the manufacturer’s protocol. To assess mutation frequencies, T7EI endonuclease assays were performed [15 (link)]. The genomic region (gRNA target site) was PCR amplified using primers (Table 1 ). PCR products were mixed with 2μL NEB buffer 2.0 (New England Biolabs) and water to make a total volume of 20μL. The mixture was denatured and annealed to form heteroduplexes. After that, we performed digestion with 0.32μL T7EI endonuclease (10 units/μL) at 37°C for 30 minutes. To analyze DNA digestion, the products were electrophoresed on a 2.5% agarose, 50% sucrose with proteinase K (20 ng/μL) gel. The mutation rate was quantified by scanning of DNA bands with Image J software (NIH Image-BioLab). The PCR products were sent for Sanger sequencing.
To identify the mutant alleles, the PCR products were cloned by TOPO TA Cloning Kit (Life Technologies) vector prepared according to the manufacturer's instructions and sent for Sanger sequencing.
To identify the mutant alleles, the PCR products were cloned by TOPO TA Cloning Kit (Life Technologies) vector prepared according to the manufacturer's instructions and sent for Sanger sequencing.
10
FFPE DNA Extraction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extraction from FFPE was performed by following standard protocols (Senguven, Baris, Oygur, & Berktas, 2014 ). Briefly, tumor cells were collected from an H&E stained section that was demarcated by a pathologist. The cells were deparaffinized by incubation with xylene at 56°C for 1 hr. Xylene was removed and the cells were washed with descending concentrations of ethanol and the pellet was allowed to dry at 56°C for 10 min. This was followed by DNA isolation using the QIAmp DNA micro kit (Qiagen catalog number 56304). The isolated DNA was measured on Nanodrop, and used for further experiments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!