ChIP assay was performed with a ChIP assay kit (#17-371; Millipore) according to the manufacturer’s instructions. Briefly, chromatin DNA was crosslinked by adding formaldehyde directly into the media at a final concentration of 1% and incubated at room temperature for 10 min. Crosslinking reaction was stopped by adding excessive glycine. The cells were washed, scraped, pelleted, and lastly lysed in SDS lysis buffer. Crosslinked DNA was sheared by sonication. Chromatin was diluted 10-fold with ChIP dilution buffer. Chromatin was precipitated with their respective antibodies. IP was performed using 3 μg of rabbit polyclonal anti-acetyl-Histone H3 (#07-353; Sigma-Aldrich), anti-acetyl-Histone H3 (Lys14; #07-353; Sigma-Aldrich) or anti-SRFBP1 (ab109598; Abcam) antibodies, and 1 μg of rabbit IgG was used as negative control. Incubation was performed overnight at 4°C with rotation. To collect the antibody/antigen/DNA complex, 60 μl Protein G Agarose was added to each IP and incubated for 1 h at 4°C with rotation. Enriched chromatin DNA was then purified for further qRT-PCR. Primers for qRT-PCR were reported (Grandori et al., 2005 (link)) or designed and listed in Table S6 .
Anti acetyl histone h3
Manufactured by Merck Group
Sourced in United States, United Kingdom, China
Anti-acetyl-histone H3 is a laboratory reagent used in various research applications. It is a specific antibody that binds to the acetylated form of histone H3, a histone protein involved in the compaction of DNA within eukaryotic cells. This product can be used to detect and quantify the levels of acetylated histone H3 in biological samples, providing insights into chromatin structure and gene regulation.
Automatically generated - may contain errors
Lab products found in correlation
Anti acetyl histone h4, by Merck Group (15 mentions)
Anti histone h3, by Abcam (4 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (4 mentions)
Chip assay kit, by Merck Group (3 mentions)
Anti trimethyl h3k4, by Merck Group (3 mentions)
Anti acss2, by Cell Signaling Technology (3 mentions)
Anti histone h3, by Merck Group (3 mentions)
Anti h3, by Merck Group (2 mentions)
Bioruptor, by Diagenode (2 mentions)
Anti ha y 11, by Santa Cruz Biotechnology (2 mentions)
Anti h3k4me3, by Abcam (2 mentions)
Anti flag, by Merck Group (2 mentions)
250 sonicator, by Emerson (2 mentions)
Anti acss1, by Thermo Fisher Scientific (2 mentions)
Anti acss3, by Thermo Fisher Scientific (2 mentions)
Polyvinylidene difluoride membrane, by Merck Group (2 mentions)
Anti tubulin, by Proteintech (2 mentions)
Protease inhibitor cocktail, by Roche (2 mentions)
Anti β actin, by Merck Group (2 mentions)
Anti brg1, by Santa Cruz Biotechnology (2 mentions)
61 protocols using anti acetyl histone h3
1
Chromatin Immunoprecipitation (ChIP) Assay Protocol
2
ChIP-Seq of Histone Modifications in Aging Liver
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Snap‐frozen mouse liver (100 mg) from young and old wild‐type mice was used to prepare chromatin. ChIP and H3K14ac ChIP‐Seq were performed as described previously (Whitton et al., 2018 ). For Setdb1 and Kap1, a few modifications were incorporated. Particularly, sonication, using Diagenode Bioruptor Pico, was reduced to 11 cycles (30 s pulse on, 30 s pulse off) and libraries were sequenced using Illumina NextSeq 500 following the manufacturer's protocols. Rabbit polyclonal antibodies specific to KAP1 (Abcam, ab10483), SETDB1 (Proteintech, 11231–1‐AP), and anti‐acetyl‐histone‐H3 specific to Lys‐14 (Millipore, 07–353) were used for immunoprecipitation.
For sequential ChIP, the first immunoprecipitation was performed as described for ChIP (Whitton et al.,2018 ) with some modifications. After the washes, samples were eluted in 100 µl 1% SDS and 10 mM fresh dithiothreitol (DTT) twice for a total elution volume of 200 µl. After each elution, the samples were rotated at 37ºC for 15 min. After the second elution, samples were diluted in TE to 1.5 ml. Then, the second antibody was added and the second ChIP was performed as described previously (Whitton et al., 2018 ). Rabbit antihistone H3 (trimethyl K9) antibody (ab8898) and anti‐acetyl‐histone‐H3 specific to Lys‐14 (Millipore, 07–353) were used for immunoprecipitation.
For sequential ChIP, the first immunoprecipitation was performed as described for ChIP (Whitton et al.,
3
ChIP-qPCR Quantification of Histone Acetylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Livers were homogenized and incubated in a fixation solution (1% formaldehyde, 4.5 mM HEPES [pH 8.0], 9 mM NaCl, 0.09 mM EDTA, 0.04 mM EGTA) in 10% phosphate-buffered saline (PBS) for 30 min at 37 °C. Reactions were terminated by adding glycine to a final concentration of 150 mM. After washing in FACS solution (PBS, 2% bovine serum, 0.05% NaN3), the samples were sonicated in SDS lysis buffer (50 mM Tris-HCl [pH 8.0], 10 mM EDTA [pH 8.0], 1% SDS, 0.5 mM phenylmethanesulfonylfluoride) to generate DNA fragments of 200–500 bp. The immunoprecipitation was performed using anti-acetyl-histone H3 (#06–559, Sigma-Aldrich, MO, USA) and anti-acetyl-histone H4 (#06–598, Sigma-Aldrich) antibodies. The precipitated DNA was subjected to real-time PCR using primers corresponding to the indicated sites in the promoter/enhancer and transcribed regions. The CT values of the ChIP signals detected by real-time PCR were converted to percentages of the signal for input DNA using the delta-delta method, with formula 100 × [2(CTinput−CTIPsample)]. The primer sequences used in ChIP assays are listed in Supplemental Table 2 .
4
Quantifying Histone H3 Acetylation Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To analyze the acetylation level of histone H3, 100 μg of total protein was electrophoresed on a 12% SDS-PAGE gel and then transferred to a PVDF membrane (Bio-Rad, Hercules, CA, US). The global acetylation level of histone H3 was detected by anti-acetyl histone H3 (Sigma-Aldrich). Antibodies against the acetylation levels of different lysine sites in histone H3 (H3K4, H3K9, H3K14, H3K18, H3K23, H3K27, and H3K56) were all purchased from Active Motif (Carlsbad, CA, US) and diluted 1:2,000 for Western blot analysis. Histone H3 protein was assayed with anti-H3 (Merck Millipore; 1:1,000 dilution). All blots were imaged by the chemiluminescence detection system (Clarity Western ECL, Bio-Rad), and the signal intensities of all bands were quantified using Image J software (https://imagej.nih.gov/ij ). The experiments were repeated 3 times.
5
Protein Extraction and Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The proteins in the cells were extracted with Pro-Prep (Intron Biotechnology, Seongnam, Korea) and centrifuged after sonication. A total of 20 μg of each protein was separated with SDS-polyacrylamide gel electrophoresis (PAGE). After the size-dependent separation, the proteins were transferred to polyvinylidene difluoride (PVDF) membranes using semi-dry transfer (Bio-Rad, Hercules, CA, USA). The membranes were incubated with primary antibodies overnight at 4 °C, followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies (Abcam, Cambridge, UK) for 1 h at room temperature. The signals were detected with chemiluminescence reagents (Abclon). Anti-acetyl histone H3 (Merck Millipore, 06-599, Burlington, MA, USA), anti-histone H3 (Santa Cruz Biotechnology, SC-10809, Dallas, TX, USA), anti-acetylated α tubulin (Santa Cruz Biotechnology, SC-23950), anti-tubulin (Santa Cruz Biotechnology, SC-32293), anti-Runx2 (Abcam, ab23981), and anti-Adiponectin (Cell Signaling Technology, #2789, Danvers, MA, USA) were used for the immunoblotting assay in this study. The levels of acetyl H3 and acetylated α tubulin were quantified with ImageJ and normalized to the quantified levels of H3 and α tubulin.
6
ChIP-seq of Acetylated Histone H3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Standard ChIP assays were performed as previously described [50 (link)]. The analyzed region is shown in Figure S3A . Anti-Acetyl-Histone H3 (Merck, Rahway, NJ, USA; 06-599) antibody was used and primers are listed in Table S5 .
7
ChIP-qPCR Analysis of GnIH in Hypothalamus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hypothalamic samples from female mice induced into hypothyroidism or hyperthyroidism were subjected to chromatin immunoprecipitation (ChIP) assay by using SimpleChIP kit (Cell Signaling Technology; CST, Danvers, MA, USA), as instructed by the manufacturer’s protocol. After cross-linking with 37% formaldehyde (Sigma-Aldrich), hypothalamic tissue was disaggregated by Dounce homogenizer, and then sonicated by Bioruptor (Diagenode Inc., Denville, NJ, USA). Digested chromatin samples were immunoprecipitated with following antibodies; anti-TRα/β (Santa Cruz Biotechnology, Inc. USA, sc772), anti-acetyl Histone H3 (EMD Millipore #06-599), normal IgG (CST #2729), anti-Histon H3 (CST #4620), anti-Histone H3 tri-methyl K9 (Abcam, Cambridge, UK, ab8898). Cross-linking was reversed, and the DNA was purified. The recovered DNA was subjected to qPCR by using specific primers (Supplementary Table 1 ) designed to detect enrichment in the promoter region of mouse GnIH.
8
Comprehensive Antibody Characterization Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following commercially available antibodies used were: anti-PAI-1 (clone 41/PAI-1; BD Biosciences), anti-p53 (DO-1; Calbiochem), anti-β-actin (AC-15; Sigma), anti-phospho-Smad2 (Ser465/467) (138D4; Cell Signaling Technology), anti-Smad2/3 (clone 18/Smad2/3; BD Bioscience), anti-CBP (A-22; Santa Cruz Biotechnology), anti-acetyl-Histone H3 (catalog no. 06–599; EMD Millipore), anti-Myc (4A6; EMD Millipore), anti-FLAG (M2; Sigma), anti-HA (Y-11; Santa Cruz Biotechnology), and anti-GFP (B-2; Santa Cruz Biotechnology). Mouse immunoglobulin G1 (IgG1) (MB002; R & D Systems) and rabbit IgG (Southern Biotech) were used as controls.
9
Chromatin Immunoprecipitation of PPARγ in MIN6 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MIN6 cells were cultured with or without 10 μmol/L PIO for 48 h in a 10‐cm dish. We carried out the chromatin immunoprecipitation (ChIP) assay using an EZ‐ChIP chromatin immunoprecipitation kit (Merck Millipore, Billerica, MA, USA). After fixing with 1% formaldehyde, cells were lysed, briefly sonicated and immunoprecipitated at 4°C overnight. The following antibodies were used in the ChIP reactions: normal rabbit immunoglobulin G (Santa Cruz Biotechnology, Dallas, TX, USA), anti‐acetyl histone H3 (Merck Millipore) and anti‐peroxisome‐proliferator activated receptor (PPAR; Santa Cruz Biotechnology). We washed the ChIP reactions, and eluted chromatin based on the manufacturer’s protocol. Chromatin was purified with PCR clean up columns (Qiagen), and PCRs were carried out with AmpliTaq Gold PCR Master Mix (Thermofisher).
The following primers, designed for mouse genes, were used.
ADM‐P1 forward: 5′‐ CAAACTTGGCAAGCACTCAG‐3′
ADM‐P1 reverse: 5′‐ AATGGGCTAGGACACACTCC‐3′
ADM‐P2 forward: 5′‐ CAAACTTGGCAAGCACTCAG‐3′
ADM‐P2 reverse: 5′‐ ACGGGTACTCCAAATGAAGG‐3′
ADM‐P3 forward: 5′‐ AAACCCCAATTTCCAATTCAG‐3′
ADM‐P3 reverse: 5′‐ GAAGGGGAACCAGAACAACTC‐3′
The following primers, designed for mouse genes, were used.
ADM‐P1 forward: 5′‐ CAAACTTGGCAAGCACTCAG‐3′
ADM‐P1 reverse: 5′‐ AATGGGCTAGGACACACTCC‐3′
ADM‐P2 forward: 5′‐ CAAACTTGGCAAGCACTCAG‐3′
ADM‐P2 reverse: 5′‐ ACGGGTACTCCAAATGAAGG‐3′
ADM‐P3 forward: 5′‐ AAACCCCAATTTCCAATTCAG‐3′
ADM‐P3 reverse: 5′‐ GAAGGGGAACCAGAACAACTC‐3′
10
Signaling Pathway Profiling Using Antibodies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following primary antibodies were used: anti-RTA mouse monoclonal antibody was prepared in our laboratory; anti-Notch1 (Cell Signaling technology, #4380P), anti-cleaved Notch1 (Cell Signaling technology, #4147P), anti-JAG1 (Cell Signaling technology, 2620P), anti-HIF1-α (BD Biosciences, 610958), anti-acetyl-Histone H3 (Merck Millipore, 06–599), anti-H3K4me3 (Abcam, ab8580), anti-p-IKKα/β, anti-IKKα, anti-IKKβ, anti-IκBα, anti-p-IκBα, anti-p65 (Cell Signaling technology, 9958), anti-Flag (Sigma, F7425 and F1804), and anti-HA (Sigma, H9658 and H6908). The secondary antibodies were as follows: goat anti-mouse IRDye@800cw (LI-COR, 926–32210), goat anti-rabbit IRDye@800cw (LI-COR, 926–32211), goat anti-rabbit IgG(H+L) Alexa Fluor@488 (Invitrogen, R37116), and goat anti-mouse IgG(H+L) Alexa Fluor@555 (Invitrogen, A-21422). Other reagents used and their sources were as follows: anti-Flag M2 affinity gel (Sigma, A2220), DAPT (Sigma, D5942), LY-411575 (Sigma, SML0506), NF-κB inhibitor BAY 11–7082 (Beyotime, S1523), Wnt inhibitor Salinomycin (Sigma, S4526), and TNFα (Peprotech, 315-01A).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!