Rnasin plus

Manufactured by Thermo Fisher Scientific

RNasin Plus is a recombinant ribonuclease inhibitor protein that binds to and inhibits ribonuclease activity. It is a lab equipment product designed for use in molecular biology applications.

Automatically generated - may contain errors

Lab products found in correlation

10 protocols using rnasin plus

Affinity Purification of TDP-43 Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

100 third instar larvae expressing TDP-43^WT-YFP or TDP-43^G298S-YFP were collected and flash frozen in liquid nitrogen. Frozen larvae were homogenized in lysis buffer (100 mM HEPES Buffer pH 8.0, 1% Triton X-100, 200 mM NaCl, 30 mM EDTA, 350 mM Sucrose, 10% Glycerol, 1 mg/mL Heparin, 1 mM DTT, protease inhibitors (Millipore Sigma 11,873,580,001) and RNAsin Plus 400 units/ml (Fischer Scientific PRN2615). Lysates were centrifuged at 10,000 × g for 10 min and then pre-cleared with magnetic beads (Dynabeads Protein A, Thermofisher Scientific 10001D) for 1 h at 4 °C. Magnetic beads bound to chicken anti-GFP antibody (Life tech A-11122) were added to the supernatant followed by rotation at 4 ºC for 2 h. Next, beads were washed 3 times with a sugar-rich buffer (100 mM HEPES Buffer pH 8.0, 1% Triton X-100, 200 mM NaCl, 30 mM EDTA, 350 mM Sucrose, 10%, Glycerol, 1 mg/mL Heparin, 1 mM DTT, RNAsin Plus 400 u/ml) and 2 times with a low-density buffer (100 mM HEPES Buffer pH 8.0, 1% Triton X-100, 200 mM NaCl, 30 mM EDTA,1 mg/mL Heparin, 1 mM DTT, RNAsin Plus 400 units/ml (Fischer Scientific PRN2615) followed by resuspension in Qiagen RLT buffer (Qiagen 79,216) with 1% 2-mercaptoethanol (Sigma Aldrich M6250).

Lehmkuhl E.M., Loganathan S., Alsop E., Blythe A.D., Kovalik T., Mortimore N.P., Barrameda D., Kueth C., Eck R.J., Siddegowda B.B., Joardar A., Ball H., Macias M.E., Bowser R., Van Keuren-Jensen K, & Zarnescu D.C. (2021). TDP-43 proteinopathy alters the ribosome association of multiple mRNAs including the glypican Dally-like protein (Dlp)/GPC6. Acta Neuropathologica Communications, 9, 52.

+ Open protocol

+ Expand

Radiolabeled Stalled Transcription Elongation Complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Radiolabeled stalled TECs were assembled in 20 μL reactions: 50 nM DNA template, 40 mM Tris-HCl pH 7.5, 20 mM MgCl₂, 50 nM T7 enzyme, 200 uM GTP, 200 uM ATP, 50 uM UTP, 1U/μL RNasin Plus (Thermo), 20 μCi ³²P-α-ATP. Stalling reactions were incubated at RT for 2 mins and then heparin was added to 1 mg/mL. Immediately following stalling, reactions were diluted to 30 μL with restart mixture: 40 mM Tris-HCl pH 7.5, 20 mM MgCl₂, 2 mM NTPs (GTP, ATP, UTP, CTP), 2 U RNasin Plus. Aliquots (3 μL) were taken from the reaction mixture, quenched in stop buffer (95% formamide, 25 mM EDTA), and placed on ice. Samples were loaded onto a pre-run 6% denaturing sequencing gel and run at 55 W for 4 – 5 hours at RT. Sequencing gels were transferred to filter paper, dried, exposed to a phosphorimaging screen overnight, and imaged using a phosphorimager (GE Typhoon). Gels were quantified using FIJI (Schindelin et al., 2012 (link)).

Rodgers M.L, & Woodson S.A. (2019). Transcription increases the cooperativity of ribonucleoprotein assembly. Cell, 179(6), 1370-1381.e12.

+ Open protocol

+ Expand

Fractionation of Drosophila and Human Samples

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fractionations of both overexpression and CRISPR Drosophila models were conducted as previously described [14 (link)]. In brief, 25 third instar larvae (for the overexpression models) or 1–2 days old 25 homozygous flies (for the CRISPR lines) were homogenized in Trizol (Thermofisher Scientific 15596026). Lysates were then centrifuged at 25,000×g for 30 min. The supernatant became the soluble fraction and the pellet was solubilized in urea buffer (30 mM Tris, 7 M Urea, 2 M Thiourea, 4% CHAPS, 1X Protease Inhibitor Cocktail (Millipore Sigma 11873580001), 0.5 mM PMSF, RNAsin Plus 400 units/ml (Fischer Scientific PRN2615), pH 8.5) to generate the urea/insoluble fraction. For human fractionation samples, post-mortem tissue (four spinal cord and two cerebellum samples as controls) was homogenized and subjected to the fractionation protocol described above.

+ Open protocol

+ Expand

EdU Labeling and Flow Cytometry

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

EdU labelling was performed using a Click-iT™ EdU Alexa Fluor™ 488 Flow Cytometry Kit (Thermo Fisher Scientific) following the manufacturer’s instructions. EdU reaction mixture consisted of 219 μl PBS, 5 μl CuSO₄, 25 μl 1× buffer additive and 1.25 μl Alexa Fluor dye. Cells were counterstained in DAPI and analysed on a Fortessa (BD Biosciences) flow cytometer. To isolate cells by flow cytometry following CCNB1 staining, cells were processed as previously described (39 (link)). For sorting on EdU, cells were incubated in a modified reaction cocktail [209 μl PBS, 5 μl CuSO₄, 25 μl 1 M l-ascorbic acid (Sigma, A2174), 1.25 μl Alexa Fluor 488 dye, 10 μl RNasin Plus] (Thermo Fisher Scientific) and incubated on ice for 30 min in dark.

Channathodiyil P., May K., Segonds-Pichon A., Smith P.D., Cook S.J, & Houseley J. (2022). Escape from G1 arrest during acute MEK inhibition drives the acquisition of drug resistance. NAR Cancer, 4(4), zcac032.

+ Open protocol

+ Expand

FFPE Tissue Preparation for RNA-seq

Check if the same lab product or an alternative is used in the 5 most similar protocols

For each FFPE tissue sample, a serial section adjacent to the immunofluorescence (IF) stained section was prepared for microregion retrieval and downstream RNA-seq analysis. Sections were deparaffinized and rehydrated using the Histogene Refill Kit. Slides were immersed in xylene for 5 min, followed by incubation in a second jar of xylene for 5 min. Slides were then incubated in a series of ice-cold solutions with 0.0025% RNasin Plus (Promega): 100% ethanol for 1 min, 95% ethanol for 1 min, 75% ethanol for 1 min, 1X PBS for 1 min, and another tube of 1X PBS for 1 min. Slides were stained with 50 µM DRAQ5,™ a Far-Red DNA Dye (ThermoFisher) in PBS, with 0.1% RNasin Plus for 2 min on ice.
Sections were dehydrated in a series of ice-cold solutions with 0.0025% RNasin Plus: 1X PBS for 1 min, 1X PBS for 1 min, 75% ethanol for 1 min, 95% ethanol for 1 min, 100% ethanol for 1 min. Slides were left in ice-cold 100% ethanol prior to microregion retrieval.

Maliga Z., Nirmal A.J., Ericson N.G., Boswell S.A., U’Ren L., Podyminogin R., Chow J., Chen Y., Chen A.A., Weinstock D.M., Lian C.G., Murphy G.F., Kaldjian E., Santagata S., & Sorger P.K. (2021). Micro-region transcriptomics of fixed human tissue using Pick-Seq.

+ Open protocol

+ Expand

EdU Labeling and Cell Sorting

Check if the same lab product or an alternative is used in the 5 most similar protocols

EdU labelling was performed using a Click-iT™ EdU Alexa Fluor™ 488 Flow cytometry kit (ThermoFisher Scientific) following the manufacturer's instructions, cells were counterstained in DAPI and analysed on a Fortessa (BD Biosciences) flow cytometer. Isolation of cells following CCNB1 staining was performed as described (39) . For sorting by EdU, cells were incubated in a modified reaction cocktail (209 µL PBS, 5 µL CuSO4, 25 µL 1 M L-ascorbic acid (Sigma, A2174), 1.25 µL AlexaFluor 488 dye, 10 µL RNasin Plus) (ThermoFisher Scientific) and incubated on ice for 30 minutes in dark, prior to sorting.

Channathodiyil P., Segonds-Pichon A., Smith P.D., Cook S.J., & Houseley J. (2021). DNA replication during acute MEK inhibition drives acquisition of resistance through amplification of the BRAF oncogene.

+ Open protocol

+ Expand

Mapping RNA Crosslinking Sites by Primer Extension

Check if the same lab product or an alternative is used in the 5 most similar protocols

The crosslinking products were gel-purified by electrophoresis on a 6% acrylamide sequencing gel containing 8 M urea. The crosslinking sites were mapped by primer extension. Purified RNA was incubated with ³²P-labeled oligonucleotide BLoli1915 (ACGTCCCACAGCTCAGGGAAT) or BLoli5880 (GCATGTGTGAGCCGAGTCCTGG) and dNTPs (10 nmol) in 6.5 µl of ddH₂O at 65 °C for 5 min and at 55 °C for 2 min. The reaction volume was increased to 10 µl by the addition of RNase inhibitor (RNasin Plus, 40 U), dithiothreitol (5 mM), 1× first-strand buffer (Invitrogen), and Superscript III reverse transcriptase (200 U, Invitrogen). Reaction mixtures were incubated at 55 °C for 60 min and terminated by the addition of an equal volume of formamide dye. Primer extension products were separated on 12% acrylamide sequencing gel containing 8 M urea next to a sequencing ladder as a marker. Sequencing reactions contained the same primer as used for the primer extension, pMG80 as template, and components of the Sequenase^TM Version 2.0 DNA Sequencing Kit (US Biologicals) as instructed by the manufacturer.

Tseng C.K., Wang H.F., Schroeder M.R, & Baumann P. (2018). The H/ACA complex disrupts triplex in hTR precursor to permit processing by RRP6 and PARN. Nature Communications, 9, 5430.

+ Open protocol

+ Expand

Immunoprecipitation of G3BP1 and GFP Complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293T cells or DRG neurons were lysed in 100 mM KCl, 5 mM MgCl₂, 10 mM HEPES [pH 7.4], 1 mM DTT, and 0.5% NP-40 (RIP buffer) supplemented with 1 × protease inhibitor cocktail (Roche) and RNasin Plus (Invitrogen). Cells were passed through 25 Ga needle 5–7 times and cleared by centrifugation at 12,000×g for 20 min. Cleared lysates were pre-absorbed with Protein A-Dynabeads (Invitrogen) for 30 min. Supernatants were then incubated with primary antibodies for 3 h and then immunocomplexes precipitated with Protein G-Dynabeads (Invitrogen) for additional 2 h at 4 °C with rotation. Mouse anti-G3BP1 (5 μg, BD Biosciences) and rabbit anti-GFP (5 μg, Abcam) antibodies were used for immunoprecipitation. Beads were washed six times with cold RIP buffer. Bound RNAs were purified and analyzed by RTddPCR (see below).

Sahoo P.K., Lee S.J., Jaiswal P.B., Alber S., Kar A.N., Miller-Randolph S., Taylor E.E., Smith T., Singh B., Ho T.S., Urisman A., Chand S., Pena E.A., Burlingame A.L., Woolf C.J., Fainzilber M., English A.W, & Twiss J.L. (2018). Axonal G3BP1 stress granule protein limits axonal mRNA translation and nerve regeneration. Nature Communications, 9, 3358.

+ Open protocol

+ Expand

RNA Reverse Transcription Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Four µg of RNA were added to 1.5 µL first strand buffer (Invitrogen), 1 µL RNasin^® Plus (Promega), 1 µL DNase I recombinant (Roche) and 2.5 µL H₂O. After the first incubation (20 min at 37 °C, 10 min at 70 °C), 1 µL oligo dT (Invitrogen), 0.4 µL random primer (Promega) and 2.6 µL H₂O were added and incubated for 10 min at 70 °C. Finally, 4.5 µL first strand buffer, 1.5 µL dNTP Mix (Bioline), 1 µL DTT (Invitrogen), 0.5 µL RNasin^® Plus, 1 µL SuperScript^® II Reverse Transcriptase (Invitrogen) and 1.5 µL H₂O were added to each sample. The samples were finally incubated for 50 min at 42 °C and then 10 min at 70 °C.

Hawerkamp H.C., van Geelen L., Korte J., Di Domizio J., Swidergall M., Momin A.A., Guzmán-Vega F.J., Arold S.T., Ernst J., Gilliet M., Kalscheuer R., Homey B, & Meller S. (2020). Interleukin-26 activates macrophages and facilitates killing of Mycobacterium tuberculosis. Scientific Reports, 10, 17178.

+ Open protocol

+ Expand

Immunoprecipitation of GFP-tagged Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

DRG neurons were lysed in 100 mM KCl, 5 mM MgCl₂, 10 mM HEPES [pH 7.4], 1 mM DTT, and 0.5% NP-40 (RIP buffer) supplemented with 1 × protease inhibitor cocktail (Roche) and RNasin Plus (Invitrogen). Cells were passed through 25 Ga needle 5–7 times and cleared by centrifugation at 12,000 x g, 4°C for 20 min. Cleared lysates were pre-absorbed with Protein A-Dynabeads (Invitrogen) for 3′ min. Supernatants were then incubated with rabbit anti-GFP antibody (5 μg, Abcam) for 3 h and then immunocomplexes precipitated with Protein G-Dynabeads (Invitrogen) for additional 2 h at 4°C with rotation. Beads were washed six times with cold RIP buffer and then processed for isolation of RNA as below.

Sahoo P.K., Kar A.N., Samra N., Terenzio M., Patel P., Lee S.J., Miller S., Thames E., Jones B., Kawaguchi R., Coppola G., Fainzilber M, & Twiss J.L. (2020). A Ca2+-Dependent Switch Activates Axonal Casein Kinase 2α Translation and Drives G3BP1 Granule Disassembly for Axon Regeneration. Current biology : CB, 30(24), 4882-4895.e6.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!