Mircute mirna qpcr detection kit

Manufactured by Tiangen Biotech

Sourced in China, United States, Switzerland, Japan

The MiRcute miRNA qPCR Detection Kit is a real-time PCR-based assay designed for the detection and quantification of microRNA (miRNA) expression. The kit provides a reliable and sensitive method for the analysis of miRNA levels in various biological samples.

Automatically generated - may contain errors

Lab products found in correlation

Mircute mirna first strand cdna synthesis kit, by Tiangen Biotech (55 mentions) Trizol reagent, by Thermo Fisher Scientific (40 mentions) Mircute mirna isolation kit, by Tiangen Biotech (26 mentions) Fastquant rt kit, by Tiangen Biotech (11 mentions) Sybr premix ex taq, by Takara Bio (7 mentions) Applied biosystems quantstudio 3, by Thermo Fisher Scientific (7 mentions) Primescript rt reagent kit, by Takara Bio (7 mentions) Abi 7500 real time pcr system, by Thermo Fisher Scientific (6 mentions) Sybr premix ex taqtm, by Takara Bio (6 mentions) Mircute mirna first strand cdna kit, by Tiangen Biotech (5 mentions) Cytoplasmic nuclear rna purification kit, by Norgen Biotek (4 mentions) Trizol, by Thermo Fisher Scientific (4 mentions) Sybr premix ex taq kit, by Takara Bio (3 mentions) Abi 7500 fast real time pcr system, by Thermo Fisher Scientific (3 mentions) Primescript rt master mix, by Takara Bio (2 mentions) Transstart tip green qpcr supermix, by Transgene (2 mentions) Mircute mirna purification kit, by Tiangen Biotech (2 mentions) 7500 real time pcr system, by Thermo Fisher Scientific (2 mentions) M mlv reverse transcriptase, by Promega (2 mentions) Superscript 3 reverse transcription kit, by Thermo Fisher Scientific (2 mentions)

Spelling variants of this product

MiRcute Plus miRNA qPCR Detection Kit (65 citations) MiRcute miRNA qPCR Detection Kit (SYBR Green; (46 citations) MiRcute Plus miRNA qPCR Detection Kit (SYBR Green) (15 citations) MiRNA qPCR kit (8 citations) MiRNA qPCR detection kit (3 citations) QPCR Detection Kit (3 citations) MiRcute miRNA qPCR detection kit (SYBR) (3 citations)

94 protocols using mircute mirna qpcr detection kit

HNSCC Tissue Sample Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tissue samples from patients undergoing curative treatment for definitely diagnosed HNSCC were obtained by surgery, with half of each sample quickly frozen in liquid nitrogen and stored at −80 °C until use and the other half embedded in paraffin for pathological examination. All patients selected in the study were informed consent in advance. In parallel, a separate cohort of 47 patients also was assembled from a large pool of patients in the database based on histologic diagnosis of HNSCC who had undergone radical surgery. We retrospectively reviewed the medical records of patients with HNSCC. In this study, we retrospectively reviewed the medical records of patients. Total RNAs were extracted from paraffin blocks using the high pure miRNA isolation kit according to the manufacturer’s protocol (Roche, Switzerland) before further analysis.
Both the miR-645 inhibitor and its mimics were purchased from GenePharma (Shanghai, China). The high pure miRNA isolation kit was purchased from Roche (Basel, Switzerland). The miRcute miRNA qPCR detection kit and miRcute miRNA qPCR detection kit were purchased from TIANGEN BIOTECH (Beijing, China).

Sun Q., Chen S., Zhao X., Yan M., Fang Z., Wang H., Zhao J., Sun M., Han X., Chen W, & Li X. (2015). Dysregulated miR-645 affects the proliferation and invasion of head and neck cancer cell. Cancer Cell International, 15, 87.

+ Open protocol

+ Expand

Breast Cancer miRNA Isolation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

All samples were obtained by surgery and quickly frozen in liquid nitrogen and stored at -80°C. Informed consent was obtained in advance for all patients selected in this study. In parallel, a separate cohort of 84 patients was assembled from a large pool of patients in the database based on histological diagnosis of breast cancer between 2001 and 2005. We retrospectively reviewed the medical records of patients. Total RNAs were extracted from paraffin blocks using the high pure miRNA isolation kit according to the manufacturer’s protocol (Roche, Switzerland) before further analysis.
Both the miR-639 inhibitor and its mimics were purchased from GenePharma (Shanghai, China). The high pure miRNA isolation kit was purchased from Roche (Basel, Switzerland). The miRcute miRNA qPCR detection kit and miRcute miRNA qPCR detection kit were purchased from TIANGEN BIOTECH (Beijing, China).

Li L., Qiu X.G., Lv P.W, & Wang F. (2014). miR-639 promotes the proliferation and invasion of breast cancer cell in vitro. Cancer Cell International, 14, 39.

+ Open protocol

+ Expand

Quantitative Analysis of miR-155 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs (<200 nt) were extracted with a miRcute miRNA Isolation Kit according to the manufacturer’s protocol (Tiangen Biotech, Beijing Co., Ltd). Total RNAs were then transcribed into cDNA with a miRcute miRNA First-Strand cDNA Synthesis Kit (Tiangen Biotech, Beijing Co., Ltd). Subsequent PCR reactions were assembled in a 20 µl system with a miRcute miRNA qPCR Detection Kit (Tiangen Biotech, Beijing Co., Ltd) with a miR-155 specific forward primer. The forward primers of miR-155 and hsa-U6 were purchased from Tiangen Biotech, and the reverse primer was provided in the miRcute miRNA qPCR Detection Kit (Tiangen Biotech, Beijing Co., Ltd). PCR amplification was conducted according to the conditions: 1 cycle of initial denaturation (95 °C for 2 min), 40 cycles of amplification (94 °C for 20 s and 60 °C for 34 s). Quantitative real-time PCR was performed on a thermal cycler from Bio-Rad Laboratories. Results were analyzed with ABI SDS version 2.3. The relative expression level of miR-155 was calculated using the 2^−∆∆Ct method. Briefly, the cycle threshold (Ct) values were initially normalized to hsa-U6 in the same sample and designated as ∆Ct values. Subsequently, ∆∆Ct values were obtained by subtracting the ∆Ct values of the control samples from those of the treated samples.

Gu S., Lai Y., Chen H., Liu Y, & Zhang Z. (2017). miR-155 mediates arsenic trioxide resistance by activating Nrf2 and suppressing apoptosis in lung cancer cells. Scientific Reports, 7, 12155.

+ Open protocol

+ Expand

Real-time qPCR of miRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time PCR reactions were performed using an ABI 7500 real-time PCR system (Applied Biosystems, CA). Reverse transcription of the extracted miRNA was performed with miRNA-specific primers using the miRcute miRNA first-strand cDNA synthesis kit, and real-time PCR of miRNAs was performed using the miRcute miRNA qPCR detection kit according to the manufacturer’s protocol (TIANGEN BIOTECH, China), the primer is provided by the miRcute miRNA qPCR detection kit.

Li L., Qiu X.G., Lv P.W, & Wang F. (2014). miR-639 promotes the proliferation and invasion of breast cancer cell in vitro. Cancer Cell International, 14, 39.

+ Open protocol

+ Expand

Comprehensive Gene Expression Analysis by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated with TRIzol Reagent (Invitrogen) according to the manufacturer's recommendation and the cDNA was synthesized using the FastQuant RT Kit (Tiangen) which includes DNase treatment of RNA to eliminate genomic contamination. The expression patterns of each gene were performed by qPCR on a 7500 system (Applied Biosystems, USA) using SYBR® Premix Ex Taq™ (Takara) (22 (link), 28 (link)).
The small RNA was extracted by using miRcute miRNA Isolation Kit (Tiangen), and miRcute miRNA FirstStrand cDNA Synthesis Kit (Tiangen) was applied to reverse transcription of miRNAs. The expression analysis of miR-21 was executed by using the miRcute miRNA qPCR Detection Kit (Tiangen), following conditions: 94°C for 2 min, 40 cycles of two steps (94°C for 20 s, 60°C for 30 s, 72°C for 30 s). Quantification of the relative expression were done using the 2^−ΔΔCT method after normalization to β-actin or 5.8s rRNA (29 (link), 30 (link)). Three independent experiments were conducted for statistical analysis.

Chu Q., Yan X., Liu L, & Xu T. (2019). The Inducible microRNA-21 Negatively Modulates the Inflammatory Response in Teleost Fish via Targeting IRAK4. Frontiers in Immunology, 10, 1623.

+ Open protocol

+ Expand

Comprehensive RNA Isolation and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

TRIzol reagent (Thermo Fisher) was adopted for the isolation of total RNA from tissues and cells. Subsequently, cDNA was generated using PrimeScript RT Master Mix (Takara, Osaka, Japan) with random oligo for circRNA and mRNA, or using miRcute Plus miRNA First-Strand cDNA Kit (TIANGEN, Beijing, China) for miRNA. qRT‐PCR reactions were conducted using SYBR Green Realtime PCR Master Mix (SinoBio, Shanghai, China) for circRNA and mRNA, or miRcute miRNA qPCR Detection Kit (TIANGEN) for miRNA. PCR primers were as follows: circ_0001361: 5′‐GAGATGCAGCTCAGCAGGTTA‐3′ (forward) and 5′‐AATGGTGGCAGTTCCAGAGG‐3′ (reverse); VMA21: 5′‐AGACGCTCCTGTTCTTCACA‐3′ (forward) and 5′‐CATACACAAAGAGGGCCAGC‐3′ (reverse); 18S rRNA: 5′‐CTTGGTCATTTAGAGGAAGTAA‐3′ (forward) and 5′‐GCTGCGTTCTTCATCGATGC‐3′ (reverse); miR-525-5p: 5′‐GGCTCCAGAGGGATGCA‐3′ (forward) and 5′‐GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGAAAG‐3′ (reverse); U6: 5′‐GCTTCGGCAGCACATATACTAAAAT‐3′ (forward) and 5′‐CGCTTCACGAATTTGCGTGTCAT‐3′. (reverse). Circ_0001361 and VMA21 expression levels were normalized to 18S rRNA, and miR-525-5p expression was normalized to U6. 2^−ΔΔCT method was used for the analysis of data.

Shen H.Y., Shi L.X., Wang L., Fang L.P., Xu W., Xu J.Q., Fan B.Q, & Fan W.F. (2021). Hsa_circ_0001361 facilitates the progress of lung adenocarcinoma cells via targeting miR-525-5p/VMA21 axis. Journal of Translational Medicine, 19, 389.

+ Open protocol

+ Expand

Immunoprecipitation of Argonaute Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

The fat body of the B. bassiana ARSEF252 infected mosquitoes at 36 , 60, and 84 hpi were dissected, mixed, and homogenized in ice-cold RIP lysis buffer^{39 (link)}. Uninfected mosquitoes mixed with B. bassiana ARSEF252 mycelia were used as a control. Magnetic beads were pre-incubated with 5 μg of custom-made antibody against A. stephensi AGO1 (GenScript) (Supplementary Fig. 12) or normal mouse IgG (Millipore). Then, the antibody-coupled magnetic beads were incubated with 100 μl mosquito homogenates. The immunoprecipitates were pulled down and digested with protease K to release the bound sRNAs. Finally, the cDNAs were reverse transcribed using miRcute miRNA First-Strand cDNA Synthesis Kit (Tiangen). RT-PCR reactions were performed using a miRcute miRNA qPCR detection kit (Tiangen).

Cui C., Wang Y., Liu J., Zhao J., Sun P, & Wang S. (2019). A fungal pathogen deploys a small silencing RNA that attenuates mosquito immunity and facilitates infection. Nature Communications, 10, 4298.

+ Open protocol

+ Expand

Quantitative Analysis of miRNAs and Target Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from previously frozen plant tissues using RNAsimple Total RNA kit. For each examined miRNA, 1 μg of total RNA was used as the template for reverse transcription using the miRcute Plus miRNA Fist-Strand cDNA kit (TIANGEN, Beijing, China); the U6 gene was used as the internal control. Reverse transcription was performed using the following conditions: 42 °C for 60 min, 95 °C for 3 min, hold at 4 °C. For target genes, 1 μg of total RNA was used for synthesis with HiScript II Q Select RT SuperMix for qPCR (Vazyme, Nanjing, China) and an oligo (dT) 23 primer, and the gene UBQ was used as an internal control. Reverse transcription was performed using the following conditions: 50 °C for 15 min, 85 °C for 5 s, hold at 4 °C. QPCR was performed on the Bio-Rad CFX96 Real-time PCR platform. The MiRcute miRNA qPCR Detection kit (TIANGEN, Beijing, China) and ChamQ SYBR qPCR Master Mix (Vazyme, Nanjing, China), respectively, were used for the RT-qPCR assays according to the manufacturer’s protocol. The relative expression of miRNA and its target genes was calculated by the 2^–∆∆Ct method. All primers used are listed in Supplementary Table S6.

Zhang J., Xu C., Liu K., Li Y., Wang M., Tao L., Yu H, & Zhang C. (2021). Deep Sequencing Discovery and Profiling of Known and Novel miRNAs Produced in Response to DNA Damage in Rice. International Journal of Molecular Sciences, 22(18), 9958.

+ Open protocol

+ Expand

Quantification of MIR156 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated with Trizol reagent (Invitrogen, USA). For quantitative detection of the primary MIR156s, cDNA was firstly synthesized using M-MLV (Promega, USA) and detected with the TransStart Tip Green qPCR Super Mix (TransGen Biotech, China). For comparison of mature MIR156, total RNA was purified with the miRcute miRNA purification kit (Tiangen Biotech, China) and further cDNA was reverse transcribed with the miRcute miRNA first-strand cDNA synthesis kit (Tiangen Biotech, China). The mature miR156 was detected with the miRcute miRNA qPCR Detection Kit (Tiangen Biotech, China). Quantitative RT-PCR was conducted with the SYBR Premix ExTaq kit (Takara, Japan) in a total volume of 25 μL on the Applied Biosystems 7500 real-time PCR system according to the manufacturer’s manual. The level of PP2A (AT1G13320) transcript was adopted as an internal control. The expression of mature MIR156 or each primary MIR156 (pri-MIR156A~H) in different samples was calculated by the 2^ΔCt method, in which: ΔCt = Ct (_PP2A)−Ct (_target). The expression level of target gene after treatments are the ratio of expression in treated samples compared with the controls by the 2^ΔΔCt method, in which ΔΔCt = (Ct_PP2A−Ct_target) _treatment−(Ct_PP2A−Ct_target) _control.
All the primers used for qRT-PCR above are shown in Supplementary Table 1.

Xie Y., Liu Y., Wang H., Ma X., Wang B., Wu G, & Wang H. (2017). Phytochrome-interacting factors directly suppress MIR156 expression to enhance shade-avoidance syndrome in Arabidopsis. Nature Communications, 8, 348.

+ Open protocol

+ Expand

Comprehensive qRT-PCR Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

qRT-PCR analyses were performed by using an Applied Biosystems 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Total RNA from IMF tissues was isolated using the TRIzol^® Reagent (Invitrogen, Carlsbad, CA, USA); cDNAs were synthesized using a TaKaRa^® PrimeScript^TM RT reagent kit with a gDNA Eraser; and qRT-PCR analyses were carried by using TaKaRa^® SYBR^® Premix Ex TaqII (Tli RNaseH Plus). mRNA primers were designed using Primer 5.0 software (Primer-E Ltd., Plymouth, UK). The first-strand cDNA of miRNAs was synthesized using the TIANGEN^® miRcute miRNA First-Strand cDNA Synthesis kit.
The design of miRNA primers and the expression of miRNAs were carried out using the TIANGEN^® miRcute miRNA qPCR Detection kit (SYBR Green). Measurements were performed in triplicate. For validating the RNA-seq data, the geometrical mean of β-actin and Rps18 (for mRNA) or Rps18 and U6 (for miRNA) were used as a control, whereas β-actin (for mRNA) or Rps18 (for miRNA) were used as reference genes for detecting gene expression in cells. All the primers were available on request (S1 Table).

Zhang Y.Y., Wang H.B., Wang Y.N., Wang H.C., Zhang S., Hong J.Y., Guo H.F., Chen D., Yang Y, & Zan L.S. (2017). Transcriptome analysis of mRNA and microRNAs in intramuscular fat tissues of castrated and intact male Chinese Qinchuan cattle. PLoS ONE, 12(10), e0185961.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!