7500 fast real time pcr system

To collect enough bacteria, H. pylori ATCC 700392 was adjusted to 1 McF using DensiCHEK Plus densicheck (BioMerieux, French) and cultured for 2 days. In a second experiment, 1 mL of bacterial solution (OD₆₀₀ = 0.5–0.6) was diluted 50-fold in BHI broth adding 10% FBS with or without the MIC of HZQYF for 24 h. The sample’s total RNA was extracted using Purelink RNA kit. Their concentrations were determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA). On a Thermo Scientific 7,500 Fast Real-Time PCR System (Quantitative Real-Time PCR System), RT-qPCR was carried out using the SYBR Premix Ex Tap^™ kit (Takara) and following the manufacturer’s instructions. The 2^−ΔΔCt method was used to examine the data. Table 1 lists the particular primers used (Shu et al., 2016 ) to amplify mRNA fragments. The expression regulation of these genes was assessed in comparison to bacteria from the control group following normalization with the reference gene 16S.

Total RNA from different cell lines was extracted by using the E.Z.N.A. Total RNA Kit I (OMEGA, USA). The purity of each RNA sample was determined by assessing the A260/A280 ratio, which consistently measured between 1.6 and 1.8. The RNA was reverse transcribed using the PrimeScript 1st Strand cDNA Synthesis Kit (TAKARA, Dalian, China) according to the manufacturer's instructions. Then, real-time quantitative reverse transcription-polymerase chain reaction (RT-PCR) analysis was performed on an ABI 7500 FAST Real-Time PCR System by using SYBR^®Premix Ex Taq™ II (TAKARA). Quantitative determination of RNA levels were performed in three independent experiments. The housekeeping gene GAPDH was used as an internal control to normalize the expression levels of different genes. The primers used were listed in Supplementary Table S1.

Total RNA was extracted from synchronized L4 worms using TRIZOL (Invitrogen), followed by the removal of contaminant DNA using DNase I. cDNAs were synthesized from the total RNA templates using a reverse transcription kit (Takara). Primers used for qPCR of hsp-4 were primers #1 [GTGGCAAACGCGTACTGTGATGA]/[CGCAACGTATGATGGAGTGATTCT], primers #2 [TTCCGTGCTACATTGAAGCCGGTT]/[GCTTCGTCAGGGTTGATTCCACGA], primers #3 [GGACTTGTTCCGTGCTACATTGAAG]/[GCTTCGTCAGGGTTGATTCCACGA] and pmp-3F [GAATGGAATTGTTTCACGGAATGC]/ pmp-3R [CTCTTCGTGAAGTTCCATAACACGATG] for pmp-3 as the internal standard. qPCR was carried out on an ABI 7500 Fast real-time PCR system using a Takara real-time PCR kit (SYBR Premix Ex TaqTM II).

PGCs or somatic cells were disrupted in TRIzol Reagent (Takara) and total RNAs were isolated by chloroform extraction coupled with isopropanol precipitation, with 1/10 volume of 3 mol/L NaAc and 1 μL glycogen was added to the aqueous phase of each sample. RNAs were then washed twice with 75% ethanol before they were eluted with nuclease-free water. cDNA was then synthesized using All-In-One RT MasterMix (Applied Biological Materials). qPCR was carried out using TB Green Premix Ex Taq II (Takara Bio) and monitored by 7500 Fast Real-Time PCR System, and three technical replicates were performed for each sample. Relative expression level of each gene was normalized to the reference gene GAPDH. qPCR primers for tested genes are listed in Supplementary Table S1.

For the genes with sex-associated markers, gene expression was analyzed at the different developmental stages of gonadal, embryos,and larvae. Gonadal tissue were from our previous collected sample containing five stages testicular sample and six stages ovariansample (Meng et al., 2018 (link)). In addition, samples of 12 different developmental stages from fertilized eggs to young crabs were also collected based on the external features and histological configuration (Yingmin et al., 1984 ; Jun-Zeng et al., 2001a ,b ), including fertilized egg stage (F), multicellular stage (Mc), blastula stage (B), gastrulation stage (G), egg-nauplius stage (En), egg-zoea stage (Ez), zoea stage (Z1–Z4), megalopal stage (M), and juvenile crab stage (J). Total RNA was extracted individually using Trizol (Invitrogen, Carlsbad, CA, United States). Quantitative real-time PCR (qPCR) primers were designed via Primer Premier 5 tool (Premier Biosoft International) (Supplementary Table S1). First strand cDNA was synthesized using PrimeScript RT reagent kit (Takara, Dalian, China). qPCR was performed using a 7500 Fast Real-Time PCR System and SYBRPremix^® Ex Taq^TM reagent Kit (Takara, Dalian, China). The PCR was performed with the following profile: 95°C for 30 s, followed by 40 cycles of 95°C for 15 s and 60°C for 34 s.

Total RNA was extracted from the cultured cells using Trizol reagent (Invitrogen, Carlsbad, CA, USA, #15596018), RNA was quantified using NanoDrop ND-1000 and PrimeScript™ RT Master Mix (Takara Biomedical Technology, Beijing, #RR036A) was used according to the manufacturer’s instructions to perform reverse transcription. Quantitative real-time PCR (qPCR) was performed on an Applied Biosystems 7500 Fast Real-Time PCR System using TB Green^® Advantage^® qPCR Premix (Takara, #639676). GAPDH was used as an endogenous control and the relative expression levels were calculated using the 2^−ΔΔCT method. The information on primers is shown in Additional file 1: Table S3.