Fast real time pcr system
The Fast Real-time PCR System is a laboratory instrument designed for real-time polymerase chain reaction (PCR) analysis. It provides rapid and precise detection and quantification of nucleic acid sequences.
Lab products found in correlation
4 protocols using fast real time pcr system
Comprehensive Analysis of Senescence and Osteogenesis
Quantifying Mitochondrial DNA Copy Number
Primer information
Gene symbol | Primers | Sequence (5′ → 3′) | Gene ID | Product Length (bps) |
---|---|---|---|---|
COII | Forward | ACCTGGTGAACTACGACTGCTAGA | NC_005089.1 | 184 bp |
Reverse | CCCTGGTCGGTTTGATGTTACTGT | |||
Cyt B | Forward | TTCGCAGTCATAGCCACAGCATT | NC_005089.1 | 242 bp |
Reverse | TGGAGGAAGAGGAGGTGAACGATT | |||
GAPDH | Forward | GAAGGTGGTGAAGCAGGCATCT | NC_000072.7 | 116 bp |
Reverse | CGGCATCGAAGGTGGAAGAGTG |
Quantitative gene expression analysis in zebrafish
Quantifying Exosomal miRNA Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!