Total RNA was isolated with TRIzol reagent (15596026, Thermo Fisher, America) and an RNA purification kit (12183555, Thermo Fisher, America). cDNA was synthesized with the PrimeScript™ RT Reagent Kit (RR037A, TaKaRa, Japan). RT-qPCR was performed with Fast Real-time PCR System (Roche 480, Switzerland) using a TB Green® Premix Ex Taq™ Kit (RR820A, TaKaRa, Japan). The following mRNAs that related to the induction of senescence were selected: p16 (ID: 12578), p21 (ID: 12575), IL-1β (ID: 16176), and TNF-α (ID: 21926). The following mRNAs that related to the regulation of senescence were selected: Sirt1 (ID: 93759), CDK2 (ID: 12566), CDK4 (ID: 12567), cyclinD1 (ID: 12443), Bmi1 (ID: 12151), Rnf2 (ID: 19821), Suz12 (ID: 52615), and Ezh2 (ID: 14056). The following mRNAs related to osteogenesis were selected: Runx2 (ID: 12393) and Osterix (ID: 170574). The relative gene expression was normalized to β-actin. Details of the primers (Thermo Fisher, America) are shown in Supplementary Table 1 .
Fast real time pcr system
Manufactured by Roche
Sourced in Switzerland
The Fast Real-time PCR System is a laboratory instrument designed for real-time polymerase chain reaction (PCR) analysis. It provides rapid and precise detection and quantification of nucleic acid sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Rna purification kit, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Tb green premix ex taq kit, by Takara Bio (1 mentions)
D0063, by Beyotime (1 mentions)
Universal genomic dna purification mini spin kit, by Beyotime (1 mentions)
Rna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Premix ex taq, by Takara Bio (1 mentions)
Sybr green master mix, by Selleck Chemicals (1 mentions)
Trizol ls reagent, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Thermo Fisher Scientific (1 mentions)
4 protocols using fast real time pcr system
1
Comprehensive Analysis of Senescence and Osteogenesis
2
Quantifying Mitochondrial DNA Copy Number
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The relative copy number of mtDNA was determined based on the ratio of mtDNA to nuclear DNA (nDNA) and measured by qPCR assay. Cytochrome b (Cyt B) and cytochrome c oxidase subunit II (COII) were used as controls for mtDNA, and GAPDH was used as a control for nDNA. The primer sequences (synthesized by Bao Biological Engineering Co., LTD, Dalian, China) are listed in Table 1 . Total DNA was extracted from renal tissues and podocytes with a universal genomic DNA purification mini spin kit (D0063, Beyotime Biotechnology) according to the manufacturer's instructions. A Talent quantitative real-time PCR (qPCR) kit (RR003Q, Bao Biological Engineering Co., Ltd., Dalian, China) was used to perform the qPCRs (5 min denaturation step at 95 °C, then 40 cycles of 10 s at 95 °C, 30 s at 60 °C and 30 s at 70 °C) using a Fast Real-Time PCR system (Roche, Switzerland). The 2−ΔΔCt method was used to calculate the relative expression.
Primer information
| Gene symbol | Primers | Sequence (5′ → 3′) | Gene ID | Product Length (bps) |
|---|---|---|---|---|
| COII | Forward | ACCTGGTGAACTACGACTGCTAGA | NC_005089.1 | 184 bp |
| Reverse | CCCTGGTCGGTTTGATGTTACTGT | |||
| Cyt B | Forward | TTCGCAGTCATAGCCACAGCATT | NC_005089.1 | 242 bp |
| Reverse | TGGAGGAAGAGGAGGTGAACGATT | |||
| GAPDH | Forward | GAAGGTGGTGAAGCAGGCATCT | NC_000072.7 | 116 bp |
| Reverse | CGGCATCGAAGGTGGAAGAGTG |
3
Quantitative gene expression analysis in zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 16 zebrafish embryos using Trizol reagent. Reverse transcription was performed with the Thermo Scientific RNA Reverse Transcription Kit. 2× PCR Mix (TaKaRa, Premix Ex Taq) containing SYBR Green I was used for the real-time quantitative PCR analysis with the Roche Applied Science Fast Real-Time PCR System. The corresponding gene primers are shown in Table S1 . The experiment was repeated at least three times.
4
Quantifying Exosomal miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HT22 cells were seeded at a density of 1 × 10 6 cells/well in 6-well plates. Cells were treated as above. Total RNA from cells or exosomes was extracted by TRIzol LS reagent (Invitrogen, Carlsbad, USA) according to the manufacturer's protocol. Single-strand cDNA was synthesized using the PrimeScript RT reagent Kit (Fermentas, Madison, USA) under the following conditions: 42 °C for 1 h and then 95 °C for 5 min. The expression of miRNA was tested by a fast real-time PCR system ((Roche, Mannheim, Germany) using a SYBR Green master mix (Bimake, Houston, USA) with the following cycling conditions: 95 °C for 10 min followed by 40 cycles of 95 °C for 10 s and 60 °C for 1 min. U6 was used as the endogenous control of exosomal miRNA and GAPDH as the control for cells. The relative expression was normalized to that in the control group.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!