Quantstudio 5 flex real time pcr system

Total RNA was extracted from peritoneal macrophages by using RNAiso Plus (catalog no. 9108; Takara) according to the manufacturer's instruction. cDNA was synthesized using 1 μg total RNA and a cDNA Synthesis kit (catalog no. 6110A; Takara) according to the protocol. The expression of mRNA was determined by a Quantitative Real-time Polymerase Chain Reaction (qRT-PCR) kit (Takara, Japan). qRT-PCR was performed by a QuantStudio® 5 Flex Real-Time PCR System (Applied Biosystems, USA) using a SYBR Green kit (Takara, Japan), and the relative changes were quantified using the equation 2 ΔCT, in which ΔCT = CTgene–CTcontrol. The following are the primers for iNOS: sense 5′-GTTCTCAGCCCAACAATACAAGA-3′ and antisense 5′-GTGGACGGGTCGATGTCAC-3′. The following are the primers for TNF-α: sense 5′-CTGAACTTCGGGGTGATCGG-3′ and antisense 5′-GGCTTGTCACTCGAATTTTGAGA-3′. The following are the primers for IL-10: sense 5′-GCTCTTACTGACTGGCATGAG-3′ and antisense 5′-CGCAGCTCTAGGAGCATGTG-3′. The following are the primers for Arg-1: sense 5′-TTGGGTGGATGCTCACACTG-3′ and antisense 5′-GTACACGATGTCTTTGGCAGA-3′. The following are the primers for β-actin: sense 5′-ATATCGCTGCGCTGGTCGTC-3′ and antisense 5′-AGGATGGCGTGAGGGAGAGC-3′.

Recombinant plasmid DNA of the HAV VP3 gene was isolated using the pTOP Blunt V2 vector (Enzynomics, Seoul, ROK). The concentration of recombinant plasmid DNA was evaluated by measuring UV absorbance at 260 and 280 nm using a Nanodrop spectrophotometer (Thermo Fisher Scientific, CA, USA). Serial dilutions of recombinant plasmid DNA standards ranging from 10 to 10¹⁰ copies/μL were amplified using the TaqMan PCR Master Mix (Applied Biosystems) on a Quantstudio 5 Flex Real-time PCR System (Applied Biosystems). Primer sequences and PCR conditions were identical to those used for the TaqMan qPCR assay above. The copy number of plasmids per μg of DNA was determined from the total number of nucleotides using a formula described previously [13 (link)]. Each data point represents the mean cycle threshold (Ct) value obtained from triplicate experiments.

Sequences of 84 different predesigned mature miRNAs (listed in Supplementary Table S3) were detected using a Human Cardiovascular Disease miScript miRNA PCR Array (MIHS-113Z, Qiagen, Hilden, Germany), as previously described, containing a miRNA sequence from C. elegans as an exogenous normalizer (spike-in cel-miR-39) [36 (link)]. All cDNA steps and PCR setup were performed via a QuantStudio™ 5 Flex Real-Time PCR System (Applied-Biosystems, Carlsbad, CA, USA). The PCR cycling was performed according to the manufacturer’s protocol. Briefly, only miRNAs with Ct values < 30 in all samples were considered. miRNA normalized expressions were represented by ∆Ct, calculated by subtracting the global geometric mean signal from individual miRNA Ct values. The 2−∆∆Ct method was used to calculate miRNAs’ fold change.

cDNA was synthesized from 1 μg of RNA using a high-capacity RNA-to-cDNA kit (Applied Biosystems, Foster City, CA, USA) and random hexamers. qPCR was performed using the TaqMan Multiplex Master Mix (Applied Biosystems) on a Quantstudio 5 Flex Real-time PCR System (Applied Biosystems). The composition of 25 μL of the reaction mixture was 10 μL of TaqMan PCR Multiplex Master Mix (Applied Biosystems), 1 μL of cDNA template, 10 pM of each TaqMan probe, 18 pM of each forward and reverse direction primer, and 7 μL of D.W. The PCR conditions were 95°C for 10 min, followed by 45 cycles of 95°C for 15 s, 56°C for 1 min, and 65°C for 1 min. The cutoff value is 40. The sequences of each probe and primer used in this study are shown in S1 Table.

Total RNA was extracted and purified from cell pellets using an RNeasy Mini-Kit (Qiagen) following the manufacturer’s instructions. The RNA concentration was determined by a NanoDrop Spectrophotometer ND-1000 (NanoDrop Biotechnologies). Total RNA (1–2 μg) was retrotranscribed into cDNA using a High-Capacity cDNA Reverse Transcriptase Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol. Then, 20 ng of the total cDNA was subjected to qRT–PCR (at an annealing temperature of 60°C) using Power SYBR Green PCR Master Mix (TAKARA). Assays were performed in triplicate on a QuantStudio 5 Flex Real-Time PCR System (Applied Biosystems). The forward and reverse primer sequences were as follows: Arg-1(forward: 5′- CCACAGTCTGGCAGTTGGAAG; reverse: 5′- GGTTGTCAGGGGAGTGTTGATG); Ym-1 (forward: 5′- CCCTTCTCATCTGCATCTCC; reverse: 5′- AGTAGCAGTCATCCCAGCA); IL-6 (forward: 5′- GGACCAAGACCATCCAATTC; reverse: 5′- ACCACAGTGAGGAATGTCCA); Saa3 (forward: 5′- GCCTGGGCTGCTAAAGTCAT; reverse: 5′- TGCTCCATGTCCCGTGAAC); Gapdh (forward: 5′- AATGTGTCCGTCGTGGATCTGA; reverse: 5′- GATGCCTGCTTCACCACCTTCT); TNF-α (forward: 5′- AGCCCACGTCGTAGCAAACCAC; reverse: 5′- AGGTACAACCCATCGGCTGGCA); CD206 (forward: 5′- GGCAGGATCTTGGCAACCTAGTA; reverse: 5′- GTTTGGATCGGCACACAAAGTC); iNOS (forward: 5′- TCCTGGACATTACGACCCCT; reverse: 5′- CTCTGAGGGCTGACACAAGG);

qPCR was performed using primers targeting the HTNV S segment with SYBR Green PCR Master mix (Applied Biosystems) on a Quantstudio 5 Flex Real-Time PCR System (Applied Biosystems). The cycling condition and primer information were previously described [35 (link)].

After homogenization and RNA extraction of lung and intestinal (colon) tissues, RNA was reverse transcribed using the High-Capacity RNA-to-cDNA™ Kit (Applied Biosystems). qRT-PCR was performed using the Power SYBR Green PCR Master Mix on the QuantStudio™ 5 Flex Real-Time PCR System (Applied Biosystems) (Table 1 for the sequences of the oligonucleotides). The relative gene expression (2^-▵▵CT) was normalized according to the PCR cycle thresholds (Ct) for the gene of interest and the housekeeping gene coding glyceraldehyde 3-phosphate dehydrogenase (Gapdh) (^▵Ct) and to the ^▵Ct values between non-infected (mock) and infected animals.