The total RNA was extracted from cells using TRIzol (Invitrogen), and cDNA was synthesized using PrimeScript® RT regent kit (Takara Biotechnology, Dalian, China). Real-time PCR was performed with SYBR® Premix Ex Taq (Takara Biotechnology, Dalian, China). The relative gene expression levels were calculated using the 2−ΔCt method.
Primescript rt regent kit
Manufactured by Takara Bio
Sourced in Japan, China, United States
The PrimeScript RT reagent kit is a tool for reverse transcription, a process that converts RNA into complementary DNA (cDNA). It contains the necessary reagents, including the PrimeScript Reverse Transcriptase enzyme, to perform this conversion. The kit is designed to facilitate the synthesis of cDNA from RNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (19 mentions)
Sybr premix ex taq, by Takara Bio (11 mentions)
Trizol, by Thermo Fisher Scientific (11 mentions)
Trizol reagent, by Takara Bio (8 mentions)
Trizol regent, by Takara Bio (7 mentions)
Sybr premix ex taqtm, by Takara Bio (6 mentions)
Lightcycler 480 real time pcr system, by Roche (6 mentions)
Gdna eraser, by Takara Bio (5 mentions)
Cfx96 real time pcr system, by Bio-Rad (4 mentions)
Sybr premix ex taq 2, by Takara Bio (4 mentions)
Sybr premix ex taq 2 kit, by Takara Bio (4 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (4 mentions)
Fast sybr green pcr kit, by Thermo Fisher Scientific (3 mentions)
Abi prism 7300 rt pcr system, by Thermo Fisher Scientific (3 mentions)
Rnaiso plus, by Takara Bio (3 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (3 mentions)
Applied biosystems 7500 real time pcr system, by Thermo Fisher Scientific (3 mentions)
Rnaiso plus kit, by Takara Bio (2 mentions)
Sybr green premix ex taq 2 kit, by Takara Bio (2 mentions)
Trizol regent, by Thermo Fisher Scientific (2 mentions)
79 protocols using primescript rt regent kit
1
Total RNA Extraction and qPCR Analysis
2
Comprehensive lncRNA and mRNA Profiling via Microarray
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Arraystar human lncRNA microarray V3.0 (Array-Star, Rockville, MD, USA) contains the transcripts from authoritative public transcription database, and was designed for the global profiling of human lncRNAs and mRNAs. The microarray work was completed by KangChen Bio-tech (Shanghai, China).
QRT-PCR was performed to determine the relative expression levels of lncRNAs and genes. Primescript RT regent kit (TaKaRa, Dalian, Japan) was used for the reverse transcriptase (RT) reaction. In brief, the RT reaction was performed for 15 minutes at 37°C, followed by 5 seconds at 85°C and 1 minute at 4°C with Prime Script RT Master Mix. The qRT-PCR was performed to quantify the expression of lncRNAs using an ABI Prism 7900 Real-Time System (Applied Biosystems, Foster City, CA, USA) with SYBR Premix Ex Taq (Takara). The primers used in the qRT-PCR were designed by Ribo Bio-tech (Guangzhou, China) and are shown inTable 2 . β-actin was used as an internal control. The data were analyzed using the 2−ΔΔCt (∆∆Ct = [mean Ct value of lncRNA – mean Ct value of β-actin] in the AECOPD or stable COPD subjects – mean value [mean Ct value of lncRNA – mean Ct value of β-actin] in the control subjects) method and presented as relative expression level.
QRT-PCR was performed to determine the relative expression levels of lncRNAs and genes. Primescript RT regent kit (TaKaRa, Dalian, Japan) was used for the reverse transcriptase (RT) reaction. In brief, the RT reaction was performed for 15 minutes at 37°C, followed by 5 seconds at 85°C and 1 minute at 4°C with Prime Script RT Master Mix. The qRT-PCR was performed to quantify the expression of lncRNAs using an ABI Prism 7900 Real-Time System (Applied Biosystems, Foster City, CA, USA) with SYBR Premix Ex Taq (Takara). The primers used in the qRT-PCR were designed by Ribo Bio-tech (Guangzhou, China) and are shown in
3
Stress-related Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Invitrogen Inc.), and first-strand cDNA synthesized from 1 μg total RNA in a 20 μl reaction mixture with Prime Script RT regent kit (TAKARA BIOTECHNOLOGY CO., LTD). For nuclear encoded gene expression analysis, oligo dT primer was used for cDNA synthesis. For PEGs expression analysis, random primers was used for cDNA synthesis. The transcript levels of classic stress-related genes and other genes were examined with specific primers. The PCR was performed on ABI step-one instrument with the amplification conditions of 40 cycles of 95 °C for 1 min, 62 °C for 20 seconds and 72 °C for 30 seconds. UBQ5 was used as the internal control. The relative expression levels were calculated by the 2−ΔΔCT method. All the primers used are listed in Supplementary Table 1 .
4
Quantitative RT-PCR Analysis of Expansin Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent. First-strand cDNA was synthesized from 1 μg of total RNA in a 20 μl reaction mixture using a Prime Script RT regent kit (Takara). The transcript levels of EXPA5 were examined using the specific primers 5′-ttagtaatctcgcttctcgtggttc-3′ and 5′-ccataaccttggctatacagattgc-3′. The transcript levels of EXPB3 were examined using the specific primers 5′-atgcagctttttccagtcatgttag-3′ and 5′-tcacatccaccaacgtaccgtaa-3′. Arabidopsis UBQ5 was used as an internal control using the specific primers 5′-agaagatcaagcacaagcat-3′ and 5′-cagatcaagcttcaactcct-3′. The PCR was performed on an ABI7000 using the following conditions: 95 °C for 3min, followed by 40 cycles of 95 °C for 20 s, 62 °C for 20 s, and 72 °C for 31 s.
5
Quantification of miRNA and mRNA Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using Trizol reagents (15596026, Invitrogen) to extract the total RNA, using the PrimeScript RT regent Kit (RR047A, Takara) instruction to reverse transcribe the RNA complementary DNA (cDNA), using the FastSyBR Green PCR kit (Applied Biosystems) to prepare the reaction system for the synthesized cDNA, the abiprism7300 RT-PCR system (Applied biosystems) was performed for quantitative real time-polymerase chain reaction detection. Three repeats per sample. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as an internal reference. MiRNA expression was detected using PrimeScript miRNA RT_PCR kit (Takara Biotechnology co, ltd) with u6 as within the miRNA. The primers were as follows: NRST, F5′-CTTTGTCCTTATCTCAAGTTCTCG-3′, R5′-ACCTGTCTTGGCATGGGGGTTA-3′; EGFR, F5′-GGGATGAGTCAGTCAG-3′, R5′-TGGTT CATATTGTCGTCAGGT-3′; GAPDH, F5′TGCACACACTACTTAG-3′, R5′-GGACTGTGTGTGTG-3′; and miRNA-9, F5′-TCCTTTGGATCTCTCTCGCT-3’.
6
Quantitative and Semi-Quantitative RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cells and mouse lung tissues using the RNAiso Plus Kit (Takara) and cDNA synthesis was performed using the PrimeScript RT Regent Kit (Takara). Real-time quantitative RT-PCR analysis was performed as described previously (Shuto et al., 2016 (link)). α-, β-, and γ-ENaC-expression plasmids (pCMV-Tag5A) were produced previously (Sugahara et al., 2009 (link)) and used to measure the total amounts of mRNA. The sequences of primers used for real-time quantitative RT-PCR are shown in Table S1.
Semi-quantitative RT-PCR was conducted using the KOD-Plus-Neo Kit (Toyobo) according to manufacturer's protocol. PCR was performed for 35 cycles at 94 °C for 30 s, 62 °C for 30 s, and 72 °C for X s (X = 10 s for ZIP2 exons 1–2, or 60 s for ZIP2 exons 1–4), or for 25 cycles at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 10 s (for GAPDH). The sequences of primers used for semi-quantitative RT-PCR are shown in Table S1.
Semi-quantitative RT-PCR was conducted using the KOD-Plus-Neo Kit (Toyobo) according to manufacturer's protocol. PCR was performed for 35 cycles at 94 °C for 30 s, 62 °C for 30 s, and 72 °C for X s (X = 10 s for ZIP2 exons 1–2, or 60 s for ZIP2 exons 1–4), or for 25 cycles at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 10 s (for GAPDH). The sequences of primers used for semi-quantitative RT-PCR are shown in Table S1.
7
Quantifying lacZ mRNA Levels in Fission Yeast
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wild type T-variant 3A-REP41X-lacZ plasmid and three control plasmids were transformed into fission yeast hleu1-32 competent cells by electroporation and cultured on EMM plates. Total RNA was extracted by the hot phenol protocol and DNase I digested. cDNA was synthesized using PrimeScript RT Regent Kit (Takara, RR037A) according to the manufacturer's instructions. Messenger RNA abundance of lacZ (β-galactosidase reporter) from the reporter plasmid was detected by real-time PCR (oligonucleotide PCR primer sequences are detailed in Supporting data using SYBR Premix Ex Mix II (Takara, RR820A) with Amp as an internal reference. Error bars are the mean ± SD of three biological replicates.
8
Quantification of CXCL12 gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated from fibroblasts or epidermal tissues using Trizol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and first strand complementary cDNAs were synthesized using a PrimeScript RT regent kit (TaKaRa Biotech, Beijing, China). qRT-PCR was conducted using a SYBR Premix Ex TaqTM kit II (TaKaRa) with SYBR green real-time PCR mix containing 10 μmol/L forward and reverse primers of the CXCL12 gene (forward: 5′-CCT GAG GAA GGC TGA CCT CCG T-3′; reverse: 5′-AGC TCC ATT GTG CAC GGG CG-3′). Real-time PCR was performed using an ABI 7500 Real-Time PCR System and cycle parameters as follows: denaturation at 95°C for 2 min; 40 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s. The purity of each qRT-PCR product was checked by its dissociation curve. Primers were purchased from Sangon Biotech (Shanghai, China) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH, forward: 5′-AAG GTC ATC CCA GAG CTG AA-3′; reverse: 5′-CTG CTT CAC CAC CTT CTT GA-3′) was used as the reference gene. Relative quantification of gene expression levels for target and reference genes were performed using the 2−△△Ct method and was based on Ct values.
9
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of each group was extracted by TRIzol (Invitrogen, USA) according to the manufacturer’s instructions. cDNA was synthesized by using TaKaRa PrimeScript RT regent kit (TaKaRa, Japan). RT-qPCR was conducted by using SYBR on an ABI 7500 qPCR apparatus (Applied Biosystems, Life Technologies, CA, USA). The glyceraldehyde phosphate dehydrogenase (GAPDH) was used as a loading control. Primer sequences were listed as follows. PRIM1, F, ATGGAGACGTTTGACCCCAC; R, CGTAGTTGAGCCAGCGATAGT. UBE2C, F, GACCTGAGGTATAAGCTCTCGC; R, TTACCCTGGGTGTCCACGTT. GAPDH, F, GGAGCGAGATCCCTCCAAAAT; R, GGCTGTTGTCATACTTCTCATGG.
10
Quantitative Real-Time PCR Analysis of PsPIPs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction, concentration and integrity were determined as described above. First strand cDNA was synthesized using primeScript RT regent Kit (TakaRa, TAKARA Biotechnology Co. Ltd, Dalian, China) following manufacturer’s instructions, including a special step for genomic DNA elimination. Quantitative PCR analysis was conducted on an ABI 7500 Real-Time system using a SYBR Green Premix Ex-Taq™II Kit (TakaRa, TAKARA Biotechnology Co. Ltd, Dalian, China) with PsPIP gene specific primers (Additional file 3 : Table S2). The reaction mixture had a final volume of 20 µL, containing 10 µL 2× SYBR Premix Ex Taq™II, 0.4 µM of each primer, 0.4 µL 50× ROX Reference Dye II and 2 µL of tenfold dilution cDNA. The PCR conditions were: 30 s at 95 °C for pre-denaturation; 40 cycles of 5 s at 95 °C, 34 s at 60 °C. The melt-curve analysis was conducted using the method recommended by the manufacturer. The results were normalized by the geometric mean of the expression of three reference genes, i.e., elongation factor 1-alpha (EF1α, X96555), 18 s ribosomal RNA (18 s, X52575) and beta-tubulin 3 (TUB, X54846). The relative expression of PsPIPs was calculated using the 2−ΔΔCt method (Pfaffl 2001 (link); Schmittgen and Livak 2008 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!