Taqman microrna reverse transcript kit

Manufactured by Thermo Fisher Scientific

Sourced in United States

The TaqMan MicroRNA Reverse Transcript Kit is a reagent kit designed for the reverse transcription of mature microRNA (miRNA) molecules. The kit contains all the necessary components for the conversion of miRNA into complementary DNA (cDNA) templates, which can then be used for downstream quantitative PCR (qPCR) analysis.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

TaqMan kits (18 citations) TaqMan microRNA kit (15 citations) Reverse transcript kit (8 citations)

11 protocols using taqman microrna reverse transcript kit

Extraction and Analysis of miRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells using TRIzol (Sigma) or an RNeasy kit (QIAGEN). cDNA was generated using a First-strand cDNA Synthesis Kit (Thermo Fisher Scientific), a TaqMan MicroRNA Reverse Transcript Kit (Applied Biosystems), or Quantimir (Systems Biosciences). TaqMan probes for individual miRNAs were purchased from Applied Biosystems. β-Actin and miR-16 were used as internal housekeeping controls.

Khalaj M., Woolthuis C.M., Hu W., Durham B.H., Chu S.H., Qamar S., Armstrong S.A, & Park C.Y. (2017). miR-99 regulates normal and malignant hematopoietic stem cell self-renewal. The Journal of Experimental Medicine, 214(8), 2453-2470.

+ Open protocol

+ Expand

Quantitative Analysis of BM-MSC RNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs in passage 4 BM-MSCs were extracted using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. RNA integrity was determined using formaldehyde denaturalization agarose gel electrophoresis. RNA concentrations were measured by the smartspec^TM plus spectrophotometer (BIO-RAD, Hercules, CA, USA). cDNA was generated using SuperScript III First Strand Synthesis SuperMix (Takara, Dalian, China) or a TaqMan MicroRNA Reverse Transcript Kit (Applied Biosystems). TaqMan probes for individual miRNAs were purchased from Applied Biosystems. β-Actin and U6 was used as internal housekeeping controls, respectively. Quantification of mRNA and mature miRNA was performed on an ABI 7500 real-time PCR detection system (Applied Biosystems, USA) as previously described. The specific primers oligonucleotides (TaKaRa, Dalian, China) were used and relative expression of the target genes was calculated with the 2^−ΔΔCt method.

Geng L., Tang X., Wang S., Sun Y., Wang D., Tsao B.P., Feng X, & Sun L. (2020). Reduced Let-7f in Bone Marrow-Derived Mesenchymal Stem Cells Triggers Treg/Th17 Imbalance in Patients With Systemic Lupus Erythematosus. Frontiers in Immunology, 11, 233.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For total RNA and miRNA extraction, an RNeasy Mini Kit (Qiagen) was used, and for cDNA systhesis, a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) or a TaqMan MicroRNA Reverse Transcript Kit (Applied Biosystems, Waltham, MA, USA) was used based on the manufacturer’s protocol. The synthesized cDNA samples were applied to real-time PCR (a StepOnePlus Real-Time PCR System, Applied Biosystems, Waltham, MA, USA) with SYBR Select Master Mix (Applied Biosystems, Waltham, MA, USA). The primers are listed in Table S1. TaqMan MicroRNA Assays were purchased from Applied Biosystems and used for qRT-PCR analyses of miRNAs (Applied Biosystems). Expression levels of mRNA and miRNA were normalized to those of β-actin or RNU6B, respectively, and the relative expression was calculated using the 2^ΔΔCt method.

Chikuda J., Otsuka K., Shimomura I., Ito K., Miyazaki H., Takahashi R.U., Nagasaki M., Mukudai Y., Ochiya T., Shimane T., Shirota T, & Yamamoto Y. (2020). CD44s Induces miR-629-3p Expression in Association with Cisplatin Resistance in Head and Neck Cancer Cells. Cancers, 12(4), 856.

+ Open protocol

+ Expand

Cre Transfection and EV Isolation

Check if the same lab product or an alternative is used in the 5 most similar protocols

LX2 cells were transfected with Cre as described above. EVs were isolated from cell conditioned media (CM) using high speed centrifugation. RNA was isolated from cells, CM and Supernatant (Sup) using the Trizol reagent (Ambion, Life Technologies) according to the manufacturer's instructions. The amount and purity of isolated RNA was analyzed by the Nanodrop spectrophotometer (Wilmington, DE, USA). Reverse transcription was performed using TaqMan MicroRNA Reverse Transcript kit (Applied Biosystems). The resulting cDNA was then amplified in a PCR reaction using Cre-specific primers (forward primer: 5′ GCCTGCATTACCGGTCGATGC 3′; reverse primer: 5′ GTGGCAGATGGC GCGGCAACA 3′). Thermal cycle conditions used for all reactions were as follows: 5 min at 95°C, followed by 35 cycles consisting of denaturation for 30 sec at 95°C, annealing for 30 sec at 58°C, and extension for 1 min at 72°C. PCR reactions were concluded with incubation for 10 min at 72°C to complete the extension of all synthesized products. PCR products were then visualized on a 1.25% TAE agarose gel (Supplementary Figure S2).

Wang F., Li L., Piontek K., Sakaguchi M, & Selaru F.M. (2018). Exosome - miR-335 as a novel therapeutic strategy in hepatocellular carcinoma. Hepatology (Baltimore, Md.), 67(3), 940-954.

+ Open protocol

+ Expand

Quantification of miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA and miRNA were isolated from cells using the RNeasy Mini Kit (QIAGEN), and cDNA produced using the ExScript RT reagent Kit (Takara) or the TaqMan MicroRNA Reverse Transcript Kit (Applied Biosystems) according to the manufacturer’s instructions. TaqMan probes were obtained from Applied Biosystems. The cDNA samples were subjected to real-time PCR using SYBR Premix Ex Taq (Takara). The specific primers are listed in Supplementary Table 1. TaqMan MicroRNA Assays were used for qRT-PCR analyses of miRNAs (Applied Biosystems). Reactions were performed on the StepOnePlus Real-Time PCR System (Applied Biosystems). Expression levels were normalized to those of GAPDH or RNU6B, and relative expression was calculated using the 2^ΔΔCt method.

Miyazaki H., Takahashi R.U., Prieto-Vila M., Kawamura Y., Kondo S., Shirota T, & Ochiya T. (2018). CD44 exerts a functional role during EMT induction in cisplatin-resistant head and neck cancer cells. Oncotarget, 9(11), 10029-10041.

+ Open protocol

+ Expand

Quantitative Analysis of RNA and miRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA and miRNA were isolated from cells and tumour tissues using the RNeasy Mini Kit (QIAGEN), and cDNA was produced using the ExScript RT reagent Kit (Takara) or the TaqMan MicroRNA Reverse Transcript Kit (Applied Biosystems). TaqMan probes were obtained from Applied Biosystems. The cDNA samples were subjected to real-time PCR using SYBR Premix Ex Taq (Takara). The specific primers are listed in Supplementary Table 4. TaqMan MicroRNA Assays were used for qRT–PCR analyses of miRNAs (Applied Biosystems). Reactions were performed on the 7300 Real-Time PCR System (Applied Biosystems). Expression levels were normalized to those of GAPDH or RNU6B, and relative expression was calculated using the 2^ΔΔCt method.

Takahashi R.U., Miyazaki H., Takeshita F., Yamamoto Y., Minoura K., Ono M., Kodaira M., Tamura K., Mori M, & Ochiya T. (2015). Loss of microRNA-27b contributes to breast cancer stem cell generation by activating ENPP1. Nature Communications, 6, 7318.

+ Open protocol

+ Expand

Quantification of Gene and miRNA Expression by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA and miRNA were extracted from cells cultured with or without resveratrol treatment using the QIAzol and miRNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol. cDNA was generated using the PrimeScript RT reagent Kit (TaKaRa) and the TaqMan^® MicroRNA Reverse Transcript Kit (Applied Biosystems). TaqMan^® probes (TaqMan^® Gene Expression Assays and TaqMan^® MicroRNA Assays) were purchased from Applied Biosystems. qRT-PCR reactions were performed with the TaqMan probes using the Premix Ex Taq™ (Probe qPCR) (TaKaRa) and TaqMan™ Universal PCR Master Mix, no AmpErase™ UNG (Thermo Fisher Scientific) on the StepOne^® Real-Time PCR system (Applied Biosystems). Experiments were performed in at least triplicate. Expression levels of genes of interest were normalized to the expression of GAPDH and RNU44B.

Otsuka K., Yamamoto Y, & Ochiya T. (2018). Regulatory role of resveratrol, a microRNA-controlling compound, in HNRNPA1 expression, which is associated with poor prognosis in breast cancer. Oncotarget, 9(37), 24718-24730.

+ Open protocol

+ Expand

Quantitative Analysis of RNA and miRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA and miRNA were extracted from cultured cells using the QIAzol and miRNeasy Mini Kit (QIAGEN) according to the manufacturer's protocol. cDNA was generated using the PrimeScript RT reagent Kit (TaKaRa, Shiga, Japan) and TaqMan MicroRNA Reverse Transcript Kit (Applied Biosystems, Foster City, CA, USA). TaqMan probes (TaqMan Gene Expression Assays and TaqMan MicroRNA Assays) were purchased from Applied Biosystems. qRT‐PCR was performed with the TaqMan probes using Premix Ex Taq (Probe qPCR) (TaKaRa) and TaqMan Universal PCR Master Mix, no AmpErase UNG (Thermo Fisher Scientific) on the StepOne Real‐Time PCR system (Applied Biosystems). The experiments were repeated independently at least three times. Expression levels of the gene of interest were normalized to the expression of GAPDH.

Otsuka K., Yamamoto Y, & Ochiya T. (2020). Uncovering temperature‐dependent extracellular vesicle secretion in breast cancer. Journal of Extracellular Vesicles, 10(2), e12049.

+ Open protocol

+ Expand

RNA Isolation and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were isolated from cells (2 × 10⁵) using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The purity and concentration of RNA were determined by NanoDrop™ 2000 (Life Technologies; Carlsbad, CA, USA). First-strand cDNAs were synthesized using the TaqMan MicroRNA Reverse Transcript kit (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions. The PCR reactions were performed on Bio-Rad Icycler Pcr Thermal Cycler (Hercules, CA, USA) using Start Universal SYBR Green Master (Sigma-Aldrich; St. Louis, MO, USA‎). The primers used in this study were as following: miRNA-34: 5’-UGGCAGUGUCUUAGCUGGUUGU-3’ (Forward) and 5’-GUGCAGGGUCCAGGU-3’ (Reverse); U6: 5’-GCTTCGGCAGCACATATACTAAAAT-3’ (Forward) and 5’- CGCTTCACGAATTTGCGTGTCAT-3’ (Reverse); Cre: 5’-GCCTGCAT TACCGGTCGATGC-3’ (Forward) and 5’-GTGGCAGATGGCGCGGCAACA-3’ (Reverse); β-Actin: 5’-CAGGGCGTGATGGTGGGCA-3’ (Forward) and 5’-CAAACATCATCTGGGTCATCTTC-3’ (Reverse). Real-time PCR data were analyzed using 2−ΔΔCt method [55 (link)].

Shi L., Wang Z., Geng X., Zhang Y, & Xue Z. (2020). Exosomal miRNA-34 from cancer-associated fibroblasts inhibits growth and invasion of gastric cancer cells in vitro and in vivo. Aging (Albany NY), 12(9), 8549-8564.

+ Open protocol

+ Expand

Quantifying PD-L1 and miR-424-5p Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA and miRNA were isolated from cells and EVs using the RNeasy Mini Kit (QIAGEN, QIAGEN Sciences, MD, USA), and cDNA was produced using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) or the TaqMan MicroRNA Reverse Transcript Kit (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocols. The TaqMan probes were obtained from Applied Biosystems. The cDNA samples were subjected to real-time PCR using ExTaq Premix (Takara) with a StepOne Real-Time PCR System (Applied Biosciences, Thermo Fisher Scientific, Waltham, MA, USA). The data were collected and analyzed using StepOne Software v2.3 (Applied Biosciences, Thermo Fisher Scientific, Waltham, MA, USA). All mRNA and miRNA quantification data from the cultured cells were normalized according to the expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Hs02758991-g1) and U6 (RUN6B, ID: 001093), respectively.
Primers: PD-L1, Hs01125301_m1 CD274, Cat. 4331182, TaqMan. Has-miR-424-5p, ID: 000604, Cat. 4427975, TaqMan.

Zhou Y., Yamamoto Y., Takeshita F., Yamamoto T., Xiao Z, & Ochiya T. (2021). Delivery of miR-424-5p via Extracellular Vesicles Promotes the Apoptosis of MDA-MB-231 TNBC Cells in the Tumor Microenvironment. International Journal of Molecular Sciences, 22(2), 844.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!