RNA was isolated using Trizol (Invitrogen, Carlsbad, CA, USA), miR isolation kit (Qiagen, Hilden, Germany), or Hybrid R (Gene All, Seoul, Korea), and subsequently converted to cDNA using ReverTra Ace® qPCR Kit (Toyobo, Osaka, Japan) or miRCURY LNATM Universal cDNA synthesis Kit (Qiagen) according to the manufacturer’s instructions. To determine the level of gene expression, RT-qPCR was performed using the qPCR Master Mix Kit (Toyobo) or miRCURY LNATM SYBR® Green PCR Kit (Qiagen). Primer sequences used for RT-qPCR were shown in Table S1 . The primers of miR551b-3p, miR551b-5p and U6 (control) for all RT-qPCR experiments were purchased from Qiagen.
Qpcr master mix kit
Manufactured by Toyobo
Sourced in Japan
The QPCR Master Mix Kit is a reagent designed for use in quantitative real-time PCR (qPCR) experiments. It contains all the necessary components, including a DNA polymerase, buffers, and fluorescent dyes, to perform quantitative gene expression analysis.
Automatically generated - may contain errors
4 protocols using qpcr master mix kit
1
RNA Isolation and RT-qPCR Analysis of miR551b
2
RNA Isolation and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using Trizol (Invitrogen, USA) or Hybrid R (Gene All, Korea), and converted to cDNA using ReverTra Ace® qPCR Kit (TOYOBO, Japan) according to the manufacturer’s instructions. To determine the level of gene expression, RT-qPCR was performed using the qPCR Master Mix Kit (TOYOBO, Japan). Primer sequences for RT-qPCR are shown in Supplementary Table S1 .
3
RNA Isolation and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using Trizol (Invitrogen, USA) or Hybrid R (Gene All, Korea), and converted to cDNA using ReverTra Ace® qPCR Kit (TOYOBO, Japan) according to the manufacturer's instructions. To determine the level of gene expression, RT‐qPCR was performed using the qPCR Master Mix Kit (TOYOBO, Japan). Primer sequences for RT‐qPCR are shown in Supporting Information Table 1.
4
Quantifying gene expression of LPAR receptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using Hybrid R (Gene All), and equal amounts of RNA were converted to cDNA using ReverTra Ace® qPCR Kit (Toyobo) according to the manufacturer's instructions. To determine gene expression levels, PCR was performed using the qPCR Master Mix Kit (Toyobo) with primer sequence shown in Table 1 . Results were normalized to the level of GAPDH.Table 1
Sequences of RT-qPCR primers used in this study.
| Sense (5'-3') | Antisense (5'-3') | |
|---|---|---|
| LPAR1 | AGCCATGAACGAACAACAGTG | CATGATGAACACGCAAACAGTG |
| LPAR2 | TGCTACTACAACGAGACCATCG | ATGGCTGCAATAACCAGCAGA |
| LPAR3 | CAAGCGCATGGACTTTTTCTAC | GAAATCCGCAGCAGCTAAGTT |
| Gαi2 | CAACTCCTCCAGCCTAGACC | TCTCTCACGCTTCTTGTGCT |
| GAPDH | AGAAGACTGTGGATGGCCCCTC | GATGACCTTGCCCACAGCCTT |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!