Sirna sequence

Duck embryo fibroblasts (DEFs) were cultured in minimum essential medium (MEM) (Gibco, USA) containing 10% fetal bovine serum (FBS) (Gibco, USA) at 37°C in a 5% CO₂ incubator. HeLa and HEK-293T cells were maintained in Dulbecco's modified Eagle's medium (DMEM) (Gibco, USA) supplemented with 10% FBS. DTMUV strain MC (GenBank accession number KX452096) was isolated by our laboratory as previously described (25 (link)). Various tissues of three 10-day-old healthy or DTMUV-infected ducklings were obtained from an artificial infection experiment described previously in our lab (55 (link)). Tissue samples were snap-frozen into liquid nitrogen and stored at −80°C for RNA isolation. Antibodies against Flag, Myc, HA, and β-actin were obtained from Medical and Biological Laboratories (Nagoya, Japan). Anti-DTMUV E protein monoclonal antibody (MAb) was generated as previously described (25 (link)). Mouse anti-duTRIM35 antibody was stocked in our laboratory. Three pairs of small interfering RNA (siRNA) sequences targeting duTRIM35 were synthesized by GenePharma (Shanghai, China), and their sequences are listed in Table S2 in the supplemental material.

The siRNA sequences against human CHOP, DR5, and nonsilencing were chemically synthesized by Genepharma (Shanghai, China). siRNA sequences were as follows: CHOP siRNA: UUCAUCUGAAGACAGGACCUCUUGC, DR5 siRNA: AUCAGCAUCGUGUACAAGGUGUCCC, Nonsilencing siRNA: TTCTCCGAACGTGTCACGT. The commercial AMPK and control siRNA were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Concretely, EC109 and TE12 cells were plated on 6-well plates at 3 × 10⁵ cells per well and transfected with 100 pmol of siRNA duplex per well using Lipofectamine 2000 (Invitrogen) as the manufacturer’s recommendations. Cells were harvested 48 h after transfection.

For the RNAi analysis, siRNA sequences for MsTPS (GCG​UUA​CAG​GAA​CAG​GUU​UTT and AAA​CCU​GUU​CCU​GUA​ACG​CTT) as well as for the negative control (UUC​UCC​GAA​CGU​GUC​ACG​UTT and ACG​UGA​CAC​GUU​CGG​AGA​ATT) were synthesized (GenePharma, Shanghai, China) (Guo et al., 2018 (link)). The siRNA sequences were diluted and dissolved in DEPC-treated water for a final concentration of 20 µM. The first-day fourth instar larvae were injected with 2 µl siRNA for MsTPS or the negative control using a microsyringe. The larvae were fed normally after the injection.

Two pre-designed small interfering RNA (siRNA) sequences corresponding to the target sequences were directly synthesized (GenePharma). The siRNA constructs are described as follows: siRNA-NEDD4L-1: 5′-GAGTACCTATGAATGGATT-3′(sense) and 5′-AATCCATTCATAGGTACTC-3′(antisense); siRNA-NEDD4L-2: 5′-CAGAAATAATGGTCACAAA-3′(sense) and 5′-TTTGTGACCATTATTTCTG-3′ (antisense); siRNA-CPNE1-1: 5′-GCAGGUCUCGCAU GAAUUUTT-3′(sense) and 5′-AAAUUCAUGCGAGACCUGCTT-3′ (antisense). Transfection of siRNA into cells was performed with Lipofectamine 2000 according to the instructions of the manufacturer.

SiRNA sequences targeting LAMP3, MEP1A and ROS1, along with their respective negative control (NC) counterparts, were procured from GenePharma (Shanghai, China). Lipofectamine 3000 (Invitrogen) was used to transfect cells with the siRNA according to the manufacturer’s instructions for subsequent experiments. Sequences of siRNA are listed in Supplementary Table 1.

Transient knockdown of CALD1 in SW480 and SW620 cells was achieved by siRNA transfection. The siRNA sequences for CALD1 (sense 5′–3′, GGAGGAGAUGCGACUCGAATT) and normal control (NC, sense 5′–3′, UUCUCCGAACGUGUCACGUTT) were synthesized by GenePharma (Jiangsu, China). Cells with confluences of 70–80% were transfected with 100 nM CALD1 or NC siRNA using GP-siRNA-Mate (GenePharma, Jiangsu, China). After transfection for 48 h, cells were harvested and CALD1 knockdown was confirmed by WB.

The small interfering RNA (siRNA) sequences directed against mouse MMP-9 were constructed by GenePharma Corp (Shanghai, China). To locally knockdown pulmonary MMP-9 expression, 1 mg/kg MMP-9 siRNA or control siRNA was diluted in vivo jetPEI® (Polyplus, NY, USA). Aliquots of 30 μl siRNA/jetPEI mixture were injected intratracheally into the lung 48 hours before the onset of sepsis. The siRNA sequences used in this study were provided in Supplemental Table 2.