Im prom 2 system

Total RNA was extracted from third and fourth rosette leaves were extracted with TRIzol and treated with DNase I (Ambion). cDNA was synthesized using the ImPromII™ system (Promega) reverse transcription kit following the manufacturer’s instruction. The extracted cDNA was used for semi-quantitative and quantitative real time Polymerase chain reaction (RT-PCR and qRT-PCR). qRT-PCR analysis was carried out to determine the gene expression levels (CFX96 system, Bio-Rad). Transcript abundances of target genes were analyzed by the comparative threshold method, with ACTIN2 (AT3G18780) as the internal control. For visualization of amplified cDNA band in RT-PCR, 10µl of the amplified product was run in 0.8% agarose gel containing ethidium bromide.

Total mRNA was extracted from 1.0 × 10⁶ cells using TRIzol Lysis Reagent (Invitrogen, Thermo Fisher Scientific, Milan, Italy, Cat. 15596026) according to the manufacturer’s instruction. The first strand of cDNA was synthesized from 0.5–1 µg of total RNA using Im-Prom-II system (Promega, Madison, WI, USA, Cat. A3800). Real-Time PCR was performed using iTaq qPCR master mix, according to the manufacturer’s instructions (Bio-Rad, Hercules, CA, USA, Cat. 1725124), in a SFX96 real-time system (Bio-Rad, Hercules, CA, USA). To normalize raw real-time PCR data, an S18 ribosomal subunit was used. Primers used were listed in Table 3. Data are expressed as delta-C (t) of the gene of interest to S18, allowing appreciation of single gene expression levels.

Total mRNA was extracted from 1.0 × 10^⁶ cells using TRIzol Lysis Reagent (Invitrogel, Cat. 15596026) according to manufacturer’s instruction. First strand of cDNA was synthesized from 0.5–1 µg of total RNA using Im-Prom-II system (Promega, Cat. A3800). Real-Time PCR was performed using iTaq qPCR master mix according to manufacturer’s instructions (Bio-Rad, Cat. 1725124) on a SFX96 Real-time system (Bio-Rad). To normalize raw real-time PCR data, S18 ribosomal subunit was used. Data are expressed as delta-C (t) of gene of interest to S18 allowing appreciation of single gene expression level. Oligonucleotide primers were as follows: Atf4 (NM_009716.3), forward: GTTTAGAGCTAGGCAGTGAAG, reverse: CCTTTACACATGGAGGGATTAG; Xbp1 spliced (Xbp1s, NM_001271730.1), forward: AGTCCGCAGCAGGTG, reverse: GGTCCAACTTGTCCAGAATG; Herpud1 (NM_022331.2), forward: GTGGAGGAAGATGATGAGATAAA, reverse: CTCAGCGAGGAGTAGAAGTA; S18 (NM_011296), forward: TGCGAGTACTCAACACCAACA, reverse: CTGCTTTCCTCAACACCACA.