Log In Sign up
The largest database of trusted experimental protocols

Pdonr223

Manufactured by Addgene
Visit Supplier

PDONR223 is a plasmid for use in Gateway cloning. It contains the pUC origin of replication and an ampicillin resistance marker.

Automatically generated - may contain errors

Lab products found in correlation

Quickchange mutagenesis, by Agilent Technologies (1 mentions) Pdonr221, by Thermo Fisher Scientific (1 mentions) Polybrene, by Merck Group (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Bp reaction, by Thermo Fisher Scientific (1 mentions) Platinum pfx polymerase, by Thermo Fisher Scientific (1 mentions) Lr reaction, by Thermo Fisher Scientific (1 mentions) Big dye terminator kit v3, by Thermo Fisher Scientific (1 mentions) Q5 site directed mutagenesis kit, by Addgene (1 mentions) Gateway cloning system, by Thermo Fisher Scientific (1 mentions) Quikchange lightning site directed mutagenesis kit, by Agilent Technologies (1 mentions)

Close spelling variants of this product

PDONR223_MYC_WT PDONR223-PI4KAP2 PDONR223-CDK4 PDONR223 SARS-CoV-2 Nsp14 PDONR223-TIE1 plasmid PDONR223-HER3 PDONR223-EGFR-WT PDONR223-PRKAA2 PDONR223-BMP2 construct PDONR223-AXL

6 protocols using pdonr223

1

Cloning and Mutagenesis of Human Proteins

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The templates for the constructs used were as follows: human spinophilin (REFSEQ: NM_032595.4)—modified from Dr. Maria Vivo (University of Naples “Federico II”); human NF-M (Uniprot ID P07197; Transomics BC096757-seq); human PKAc—pDONR223-PRKACA; human CDK5—pDONR223-CDK5; and human p35—pDONR223-CDK5SR1 were kind gifts from William Hahn & David Root [22 (link)] (plasmid numbers 23495, 23699, and 23779, Addgene, Cambridge, MA). PCR products were generated from these template DNAs and inserted into pDONR221 (ThermoFisher, Waltham MA) for Gateway cloning into either pcDNA3.1/nV5-DEST (NF-M) or modified pcDNA3.1/nV5-DEST vectors containing an HA-tag (spinophilin), myc-tag (PKAc or p35), or FLAG-tag (CDK5) in place of the V5 tag. Mutant spinophilin (Ser17Ala) or PKA (Lys72His) constructs were generated using QuickChange mutagenesis (Agilent Technologies, Santa Clara, CA). PCR was performed with Q5 Hot Start TAQ (New England Biolabs, Ipswich, MA) or VAPRase (Vanderbilt Antibody Protein Resource, Vanderbilt University, Nashville, TN). All constructs and mutations were sequence validated (Genewiz, South Plainfield, NJ).
Hiday A.C., Edler M.C., Salek A.B., Morris C.W., Thang M., Rentz T.J., Rose K.L., Jones L.M, & Baucum AJ I.I. (2017). Mechanisms and Consequences of Dopamine Depletion-Induced Attenuation of the Spinophilin/Neurofilament Medium Interaction. Neural Plasticity, 2017, 4153076.
+ Open protocol
+ Expand
2

Lentiviral Expression of Met and Ras

Check if the same lab product or an alternative is used in the 5 most similar protocols
Full-length wild-type human Met in pDONR223 (Addgene) and all Ras cDNAs were cloned into pLenti CMV/TO Puro or pLenti CMV Blast (Addgene) by LR reaction (Life Technologies). Met or Ras active mutants were generated by PCR amplification. Lentivirus was produced by UCSF ViraCore or by co-transfection of the corresponding lentiviral vector with a packaging system into 293FT cells using the standard protocol for Lipofectamine 2000 (Invitrogen). Cells were infected with lentiviruses in the presence of polybrene (Millipore) at a final concentration of 8 μg/mL.
Fujita-Sato S., Galeas J., Truitt M., Pitt C., Urisman A., Bandyopadhyay S., Ruggero D, & McCormick F. (2015). Enhanced MET translation and signaling sustains K-Ras driven proliferation under anchorage-independent growth conditions. Cancer research, 75(14), 2851-2862.
+ Open protocol
+ Expand
3

Generation of GPS-MYC Plasmid

Check if the same lab product or an alternative is used in the 5 most similar protocols
To generate the GPS-MYC plasmid, the human MYC DNA was amplified by PCR using the following Gateway cloning primers:
attB1:5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGAAGGAGATAGAACCATGCCCCTCAACGTTAGCTTCAC-3’
attB2:5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCCTACGCACAAGAGTTCCGTAGC-3’ The resultant PCR product was cloned into pDONR223 (Addgene) with the BP reaction and subsequently cloned into the pGPS-LP vector with the LR reaction.
Blake D.R., Vaseva A.V., Hodge R.G., Kline M.P., Gilbert T.S., Tyagi V., Huang D., Whiten G.C., Larson J.E., Wang X., Pearce K.H., Herring L.E., Graves L.M., Frye S.V., Emanuele M.J., Cox A.D, & Der C.J. (2019). Application of a MYC degradation screen identifies sensitivity to CDK9 inhibitors in KRAS-mutant pancreatic cancer. Science signaling, 12(590), eaav7259.
+ Open protocol
+ Expand
4

Inducible Silencing of Mouse Myc In Vivo

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
SMART lentiviral shRNA vectors for doxycycline-inducible suppression of mouse Myc gene expression in vivo were purchased from Dharmacon as viral particles. Three vectors containing different shRNA sequences targeting mouse Myc were tested for Myc suppression in INK4.1syn-Luc cells. The sequence with most potent suppression in vitro was selected for in vivo studies.
To generate GPS-MYC, the human MYC cDNA sequence was amplified by PCR using Platinum Pfx polymerase (Invitrogen) and the following gateway attB primers:
attB1:5’GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGAAGGAGATAGAACCATGCCCCTCA ACGTTAGCTTCAC 3’
attB2: 5’GGGGACCACTTTGTACAAGAAAGCTGGGTCCTACGCACAAGAGTTCCGTAGC-3’ PCR product was purified and cloned into pDONR223 (Addgene) via BP reaction (Invitrogen). MYC was then transferred into the pGPS-LP vector via LR reaction (Invitrogen).
The pMSCV puro retrovirus vector and pMSCV puro encoding FLAG epitope-tagged MYC (T58A) were provided by Juan Belmonte (Addgene plasmid 20076) (Aasen et al., 2008 (link)). pMSCV puro vectors encoding FLAG epitope-tagged MYC S62A and S58/62A were generated as we described previously (Hayes et al., 2016 (link)).
Vaseva A.V., Blake D.R., Gilbert T.S., Ng S., Hostetter G., Azam S.H., Ozkan-Dagliyan I., Gautam P., Bryant K.L., Pearce K.H., Herring L.E., Han H., Graves L.M., Witkiewicz A.K., Knudsen E.S., Pecot C.V., Rashid N., Houghton P.J., Wennerberg K., Cox A.D, & Der C.J. (2018). KRAS Suppression-Induced Degradation of MYC is Antagonized by a MEK5-ERK5 Compensatory Mechanism. Cancer cell, 34(5), 807-822.e7.
+ Open protocol
+ Expand
5

MAX Variant Overexpression in HEK293

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293 cells (ECACC) were cultured in Dulbecco’s modified Eagle’s medium (DMEM), supplemented with 10% fetal calf serum, at 37°C in 5% CO2. The c.179G>A (p.Arg60Gln) variant was introduced into the wild-type (WT) MAX sequence in pDONR223 (Addgene #82888) via the Q5 site-directed mutagenesis kit (NEB), according to the manufacturer’s instructions. Both wild-type and mutant plasmids were cloned into the pDEST-510 destination vector via the Gateway cloning system (ThermoFisher Scientific), and the sequence was verified by Sanger sequencing with the BigDye Terminator kit v3.1.
Harris E.L., Roy V., Montagne M., Rose A.M., Livesey H., Reijnders M.R., Hobson E., Sansbury F.H., Willemsen M.H., Pfundt R., Warren D., Long V., Carr I.M., Brunner H.G., Sheridan E.G., Firth H.V., Lavigne P, & Poulter J.A. (2023). A recurrent de novo MAX p.Arg60Gln variant causes a syndromic overgrowth disorder through differential expression of c-Myc target genes. American Journal of Human Genetics, 111(1), 119-132.
+ Open protocol
+ Expand
6

Molecular Cloning of DENND5A and Interacting Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
DENND5A cDNA (Origene, SC121400) was cloned into the pCMV-tag2B
vector to generate FLAG-DENND5A. GFP-DENND5A was made via subcloning DENND5A into the
pEGFP-C1 vector. Patient variants and targeted residues for biochemical studies were
introduced using the QuikChange Lightning site-directed mutagenesis kit (Agilent)
following the manufacturer’s protocol. FLAG-DENND5A DENN domain was made by
subcloning aa1-680 of DENND5A into the pCMV-tag2B vector. GST-aa700-720 was made via oligo
annealing followed by ligation into a pGEX-4T1 vector with a modified multiple cloning
site (MCS). GST-RUN1/PLAT was created by subcloning DENND5A aa707-1090 into the pGEX-6P1
vector. MUPP1 (MPDZ) was obtained from the Harvard Medical School plasmid collection
(HsCD00352820). Untagged PALS1 (MPP5) in pDONR223 was obtained from Addgene (#23447) and
subcloned into a pCMV3-C-FLAG vector to generate PALS1-FLAG. The vector backbone from
PALS1-FLAG was then isolated and modified to include a custom MCS via oligo annealing and
ligation in order to create restriction sites suitable for subcloning MUPP1 into the
vector. MUPP1 was subcloned into this modified vector to create MUPP1-FLAG. All constructs
were confirmed by Sanger sequencing.
Banks E., Francis V., Lin S.J., Kharfallah F., Fonov V., Levesque M., Han C., Kulasekaran G., Tuznik M., Bayati A., Al-Khater R., Alkuraya F.S., Argyriou L., Babaei M., Bahlo M., Bakhshoodeh B., Barr E., Bartik L., Bassiony M., Bertrand M., Braun D., Buchert R., Budetta M., Cadieux-Dion M., Calame D., Cope H., Cushing D., Efthymiou S., Elmaksoud M.A., El Said H.G., Froukh T., Gill H.K., Gleeson J.G., Gogoll L., Goh E.S., Gowda V.K., Haack T.B., Hashem M.O., Hauser S., Hoffman T.L., Hogue J.S., Hosokawa A., Houlden H., Huang K., Huynh S., Karimiani E.G., Kaulfuß S., Korenke G.C., Kritzer A., Lee H., Lupski J.R., Marco E.J., McWalter K., Minassian A., Minassian B.A., Murphy D., Neira-Fresneda J., Northrup H., Nyaga D., Oehl-Jaschkowitz B., Osmond M., Person R., Pehlivan D., Petree C., Sadleir L.G., Saunders C., Schoels L., Shashi V., Spillman R.C., Srinivasan V.M., Torbati P.N., Tos T., Zaki M.S., Zhou D., Zweier C., Trempe J.F., Durcan T.M., Gan-Or Z., Avoli M., Alves C., Varshney G.K., Maroofian R., Rudko D.A, & McPherson P.S. (2024). Loss of symmetric cell division of apical neural progenitors drives DENND5A-related developmental and epileptic encephalopathy. medRxiv.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!