The largest database of trusted experimental protocols

Siegr1

Manufactured by RiboBio
Sourced in China

The SiEgr1 is a lab equipment product offered by RiboBio. It is designed to perform core functions related to genetic research and analysis. The detailed specifications and intended uses of this product are not available at this time.

Automatically generated - may contain errors

4 protocols using siegr1

1

Modulating miR-130a and EGR1 in HCCLM3 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
When the optimal concentration of DEX on cells was determined, HCCLM3 cells were treated with 10 nmol/L DEX for 24 h and transfected with miR-130a mimic, mimic NC, miR-130a inhibitor or inhibitor NC. At the same time, cells were also transfected with miR-130a mimic, mimic NC, miR-130a inhibitor, inhibitor NC, si-EGR1, si-NC, oe-EGR1 or oe-NC, respectively. MiR-130a mimic, inhibitor, and the corresponding NCs were compounded by Shanghai Sangon Biotechnology Co. Ltd. (Shanghai, China) while oe-EGR1, si-EGR1, and the corresponding NCs were constructed by Ribobio (Guangzhou, China). Lipofectamin 2000 reagent (Invitrogen Inc., Carlsbad, CA, USA) was adopted for cell transfection.
+ Open protocol
+ Expand
2

Transfection of SV40 MES 13 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
SV40 MES 13 cells (Chinese Academy of Sciences cell bank) were cultured in Dulbecco’s modified Eagle low-glucose medium (containing 5.5 mmol/L D-glucose) supplemented with 5% fetal bovine serum (Gibco, Australia) in a humidified 5% CO2 incubator at 37°C, and passaged every 2–3 days. Cells were treated with recombinant human TGF-β1 (10 ng/mL; Gibco, New York, USA) and transfected with pENTER-Egr1 plasmid (2 μg; Vigene Biosciences, Shandong, China) and siEgr1 (50 nM, Ribobio, Guangzhou, China) depending on the experiment. Transfections were performed using Lipofectamine™ 3000 reagent (Invitrogen, USA).
+ Open protocol
+ Expand
3

Investigating Egr1 Regulation in HK-2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human proximal tubular epithelial (HK-2) cells were cultured as described previously [19 (link)]. Depending on the experiments, HK-2 cells were treated with recombinant human TGF-β1 (10 ng/mL; Gibco, New York, NY, USA), pENTER-Egr1 plasmid (2 μg; Vigene Biosciences, Shandong, China), and small interfering RNA targeting Egr1 (siEgr1, 50 nM, RiboBio, Guangzhou, China). Transfections were performed using Lipofectamine™ 3000 reagent (Invitrogen, USA) following the manufacturer's instructions when cells were cultured to approximately 50–60% confluence in 12-well plates. Cells were harvested 48 h after transfection. TGF-β1 (10 ng/ml) was added to the culture medium 24 h before cell collection.
+ Open protocol
+ Expand
4

Regulation of Gene Expression via RNA Interference

Check if the same lab product or an alternative is used in the 5 most similar protocols
miR‐1281 mimic, inhibitor, and their corresponding negative controls, small interfering (si)‐EGR1, si‐HDAC4, si‐DNMT1, and the negative control si‐negative control were chemically synthesized by Ribobio (China). The siRNA sense sequences designed were as follows: EGR1, 5′‐CCAACAGTGGCAACACTTT‐3′; si‐HDAC4, 5′‐GGATGAGCCCTACCTAGAT‐3′; and si‐DNMT1, 5′‐TATTGGTGCATACTCTGGGCT‐3′.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!