The pDNAE6F47R expression plasmid was used for the mice immunizations, and it contains the mutated E6F47R sequence of the HPV-16 E6 gene [41 (link),42 (link)]. The pX5-E6-F47R/6C6S plasmid that contains the mutated E6F47R gene was a kind gift from G. Travé (CNRS, University of Strasbourg, Illkirch, France). This mutant was obtained by replacing one phenylalanine (F) with one arginine residue (R), and six cysteine (C) with six serine (S) residues. The first mutation prevents p53 degradation, whereas the C/S substitutions were introduced to minimize oxidation and to stabilize the protein. Briefly, after excision from the pX5-E6-F47R/6C6S plasmid using the EcoRI and NotI enzymes, the E6-F47R/6C6S gene was inserted into the pcDNA3 plasmid (Life Technologies Corp., Carlsbad, CA, USA). This plasmid was propagated in Escherichia coli XL1-Blue and extracted by alkaline lysis, followed by plasmid purification with endotoxin removal (Qiagen, EndoFree Plasmid Giga Kit, Hilden, Germany). After dissolving this plasmid in Ca2+-free and Mg2+-free phosphate-buffered saline (PBS−) to a final concentration of 1 mg/ml, this was used for immunization of the mice.
Pcdna3 plasmid
Manufactured by Thermo Fisher Scientific
Sourced in United States
The PcDNA3 plasmid is a commonly used vector for gene expression in mammalian cells. It contains a cytomegalovirus (CMV) promoter, which drives high-level expression of the gene of interest, and a multiple cloning site for easy insertion of the target gene.
Automatically generated - may contain errors
Lab products found in correlation
Pgreenpuro, by System Biosciences (3 mentions)
Endofree plasmid giga kit, by Qiagen (1 mentions)
Pdsred monomer n1, by Takara Bio (1 mentions)
Geneticin g418, by Thermo Fisher Scientific (1 mentions)
Bio glo luciferase assay system, by Promega (1 mentions)
Pcmv 3xflag plasmid, by Agilent Technologies (1 mentions)
Analytical grade solvents, by Merck Group (1 mentions)
Restriction enzymes, by Promega (1 mentions)
Cell culture medium, by Thermo Fisher Scientific (1 mentions)
Anti mouse igg peroxidase conjugate, by Merck Group (1 mentions)
Silica gel 60 chromatography plates, by Merck Group (1 mentions)
Mouse monoclonal anti β actin antibody, by Merck Group (1 mentions)
Fatty acid free bovine serum albumin, by Merck Group (1 mentions)
Anti rabbit igg peroxidase conjugate, by Merck Group (1 mentions)
Lipofectamine, by Thermo Fisher Scientific (1 mentions)
Geneticin, by Thermo Fisher Scientific (1 mentions)
Opti mem transfection medium, by Thermo Fisher Scientific (1 mentions)
Neomycin g418, by Thermo Fisher Scientific (1 mentions)
Fetal calf serum (fcs), by Thermo Fisher Scientific (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
29 protocols using pcdna3 plasmid
1
Mutated HPV-16 E6 Expression Plasmid
2
Cloning and Fusion of DmGluT1 to DsRed
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For non tagged-DmGluT1 contruction, the pUAS-DmGluT1 plasmid [45 (link)] was used to excise a 2.5 kb DmGluT1 sequence using EcoRI and XhoI restriction enzymes. The purified DmGluT1 fragment was inserted in the EcoRI and XhoI sites of the pcDNA3 plasmid (Life Technologies, USA), then ligated. The ligation boundaries were verified by sequencing.
The pDsRed-Monomer-N1 (Clontech Laboratories) plasmid was used to construct fusion of the DmGluT1 coding sequence to the N-terminus of the DsRed sequence. The pUAS-DmGluT1 plasmid was amplified with primers containing XhoI and BamHI restriction enzymes respectively, to insertion in the multiple cloning site of the DsRed vector: forward: 5' TTTTCTCGAG GCAACTGGCAACGAAATGGCT and reverse: 5' TTTTGGATCC ACATACCTGCCATTGTTGTGC. After digestions and purification, the fragment (1.5 kb) was inserted into the DsRed vector, then the sequence of the construct was verified by sequencing.
The pDsRed-Monomer-N1 (Clontech Laboratories) plasmid was used to construct fusion of the DmGluT1 coding sequence to the N-terminus of the DsRed sequence. The pUAS-DmGluT1 plasmid was amplified with primers containing XhoI and BamHI restriction enzymes respectively, to insertion in the multiple cloning site of the DsRed vector: forward: 5' TTTT
3
Luciferase Reporter Assay in C6 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cultured C6 cells were plated in 24-well plates 48 h before transfection using the calcium-phosphate coprecipitation method [32 (link)]. The cytomegalovirus-β-galactosidase plasmid was used as an internal control. Sixteen to twenty-four h after transfection, the wells were refilled with fresh medium containing the indicated concentrations of the ligand and/or PFOS for twenty-four h. Cells were harvested to measure LUC activity as described previously [32 (link)]. The total amount of DNA per well was balanced by adding the pcDNA3 plasmid (Thermo Fisher Scientific). LUC activity was normalized to that of β-galactosidase and then calculated as the relative LUC activity. All transfection experiments were repeated at least thrice. Data shown represent mean ± SEM of one experiment.
4
Geneticin Selection of Transfected Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transfection was performed using Nanofectin (PAA, Coelbe, Germany) according to the product manual. MAT-B-III cells were cultivated in a 25 cm2 flask to 50% confluence and were transfected with pGL3 control vector for luciferase expression and pcDNA3-plasmid (Thermo Fisher) to mediate geneticin resistance. To 245 µl 150 mM NaCl 2.5 µl of each plasmid solution (1µg/µl) were given, and this solution was added to a mixture of 16 µl nanofectin and 234 µl 150 mM NaCl. After mixing for 30 min at RT, the mixture was added to the cells, growing in serum-free media. After 48 h, successfully transfected cells were selected by adding geneticin G-418 (0.5 mg/ml, Thermo Fisher) to the cell culture media.
Luciferase expression was confirmed prior to the use of cells in animals using Bio-Glo™ Luciferase Assay System according to the manufacturer’s instructions (Promega, Mannheim, Germany).
Luciferase expression was confirmed prior to the use of cells in animals using Bio-Glo™ Luciferase Assay System according to the manufacturer’s instructions (Promega, Mannheim, Germany).
5
Plasmid Constructs for TDP-43 and STAU1 Studies
6
Cell Culture and Molecular Techniques
7
Generation of EphA2 Expression Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
An expression plasmid for EphA2 (accession NP_004422.2) was generated by PCR amplification using cDNA of pDONR223-EphA2 (Addgene ID:23926) [24 (link)]. The resulted amplicon was inserted into the pcDNA3 plasmid (Invitrogen). Mutant EphA2 without cytoplasmic domain (EphA2ΔIC) was created by inserting the region of human EphA2 encoding amino acids 1–560 into pcDNA3. EphA2 kinase dead mutant (EphA2K645R-plasmid) was obtained by PCR amplification using primers 5‘-ccggtggccatcaggacgctgaaagcc-3’ and 5‘-ggctttcagcgtcctgatggccaccgg-3’ which replaces Lysine to Arginine. Empty pcDNA3 was used as a control. p85-PI3K expression plasmid was purchased from Addgene (ID:11499) [25 (link)]. Transfection was performed using 1–1.5 μg/ml plasmid per well in 12 well plate using Polyethyleniminde (PEI) and OptiMEM transfection medium (Gibco). Transfection medium was changed after 5 h. Infection was performed at different time points after 20 h of transfection.
8
Transfection and Reporter Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The reporter pNF-κB-Luc expression vector contains 3 tandem copies of the NF-κB site of the conalbumin promoter driving the luciferase reporter gene. The IκBα expression plasmid was also generously provided by Dr. G. Crabtree and the reporter plasmid pLTR-Luc was a gift from Dr J. L. Virelizier (Institute Pasteur, Paris, France). The pcDNA3 plasmid (Invitrogen, Carlsbad, CA, USA) which is a cloning vector containing the CMV promoter was used in our experiments as a control for the transfection in expression plasmids or to adjust the quantities of transfected DNA. The human TNF-α promoter was provided by Dr. J. Economou (UCLA School of Medicine, Los Angeles, CA)58 (link).
9
Stable Transfection of B16 Melanoma Cells with MULT-1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MULT-1 encoding gene was amplified with GL261 cell derived cDNAs as templates using specific primers (upper primers: GGATATCATGGAGCTGACTGCCAGTAAC; lower primers: CTCGAGTCATGGGATCCCATCAATATCG), and cloned into downstream of green fluorescence protein (GFP) coding sequence in pcDNA3 plasmid (Invitrogen). After being confirmed by sequencing, the resultant plasmid (pcDNA3-GFP-MULT-1) and GFP gene carrying plasmid (PcDNA3-GFP) were stably transfected into murine B16 melanoma cells, respectively. The transfected cells were selected by limited dilution in RPMI1640 medium (Gibco) containing neomycin (G418) and 10% FCS (Invitrogen), identified by green fluorescence under fluorescence microscope and by flow cytometry, and confirmed by flow cytomerty using anti-MULT-1 mAb followed by Alexa Fluor 647-conjugated secondary antibodies. The MULT-1 gene transfected B16 cells (B16-GFP-MULT-1) and mock-transfected B16 cells (B16-GFP) were stored in liquid nitrogen and used to inoculate mice.
10
PINK1 Silencing and Overexpression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small interfering (si)RNA duplex oligonucleotide targeting PINK1 (siPINK1; cat. no. 44599) and scrambled negative control siRNA (cat. no. 37007) were purchased from Santa Cruz Biotechnology, Inc. The expression vector for PINK1 was constructed using pcDNA3 plasmid (Invitrogen, MA, USA). The open reading frames (ORFs) of the PINK1 proteins were amplified by PCR and subcloned in frame into the pcDNA3 plasmid.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!