Cas9 2a gfp

Manufactured by Addgene

Sourced in United States

The Cas9-2A-GFP is a plasmid designed to express both Cas9 and GFP proteins from a single open reading frame. It enables the visualization of Cas9 expression through the co-expression of GFP.

Automatically generated - may contain errors

Lab products found in correlation

Ha tagged ubiquitin, by Addgene (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions) Ampure xp pcr purification beads, by Beckman Coulter (1 mentions) 4d nucleofector, by Lonza (1 mentions) Sgrna t2, by Addgene (1 mentions)

5 protocols using cas9 2a gfp

Mammalian Expression Vector Flag-MSX1 Protocol

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mammalian expression vector human Flag-MSX1 [64 (link)] was kindly provided by Prof. Kyoungsook Park (Sungkyunkwan University, Seoul, South Korea). The Flag-MSX1 was further subcloned into pcDNA 3.1 Myc-vector. Flag-HA-USP11 (#22566), pQFlag-USP11 WT puroR, pQHA-USP11 WT puroR (#46749), pQHA-USP11 CS puroR (#46750 and #46747), pQFlag-USP11 CS puroR (#46748), HA-tagged ubiquitin (#18712), and Cas9-2A-GFP (#44719) were purchased from Addgene, Watertown, Massachusetts, USA.
For DUB screening, we used a plasmid encoding Cas9-2a-mRFP-2a-PAC (puromycin N-acetyl-transferase, a puromycin resistance gene) and a plasmid encoding single guide RNA (sgRNA); both constructs were purchased from Toolgen (Seoul, Korea). The sgRNA target sequences were designed using bioinformatics tools (www.broadinstitute.org, accessed on 27 January 2020) and cloned into the vectors as previously described [65 (link)]. Retroviral vectors along with packaging plasmids were kindly provided by Prof. Chang-Hwan Park and short hairpin RNA (shRNA) lentiviral vector constructs along with the packaging plasmids were kindly provided by Prof. Chung Hee Yong (both from Hanyang University, Seoul, Korea). Target sequences for the sgRNA and shRNA are listed in Supplementary Tables S1 and S2, respectively.

Kaushal K., Tyagi A., Karapurkar J.K., Kim E.J., Tanguturi P., Kim K.S., Jung H.S, & Ramakrishna S. (2022). Genome-Wide CRISPR/Cas9-Based Screening for Deubiquitinase Subfamily Identifies Ubiquitin-Specific Protease 11 as a Novel Regulator of Osteogenic Differentiation. International Journal of Molecular Sciences, 23(2), 856.

+ Open protocol

+ Expand

Genome-wide CRISPR Knockout Library Screening

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were either transfected with Cas9–2A-GFP (pX458; Addgene #48138) containing a guide RNA from the TKOv3 library (Addgene #125517) or co-transfected with Cas9–2A-GFP (pX458; Addgene #48138) together with pLV-U6g-PPB encoding a guide RNA from the LUMC/Sigma-Aldrich sgRNA library using lipofectamine 2000 (Invitrogen) (sgRNAs are listed in Supplementary Table 2 and plasmids in Supplementary Table 3). Cells were FACS sorted on BFP/GFP and plated at low density after which individual clones were isolated. Alternatively, cells were selected with puromycin (1 μg/mL) for 3 days and seeded at low density after which individual clones were isolated. Isolated knockout clones were verified by western blot analysis and/or Sanger sequencing previously described (Primers are listed in as Supplementary Table 4) ^{6 (link)}.

van der Weegen Y., de Lint K., van den Heuvel D., Nakazawa Y., Mevissen T.E., van Schie J.J., Alonso M.S., Boer D.E., González-Prieto R., Narayanan I.V., Klaassen N.H., Wondergem A.P., Roohollahi K., Dorsman J.C., Hara Y., Vertegaal A.C., de Lange J., Walter J.C., Noordermeer S.M., Ljungman M., Ogi T., Wolthuis R.M, & Luijsterburg M.S. (2021). ELOF1 is a transcription-coupled DNA repair factor that directs RNA polymerase II ubiquitylation. Nature cell biology, 23(6), 595-607.

+ Open protocol

+ Expand

CRISPR-Mediated TP53 Knockout in hESCs and RKO Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

TP53 knockout hESCs and RKO cells were generated using CRISPR/Cas9 as described previously (21 (link)) with minor modifications. Briefly, human codon-optimized Streptococcus pyogenes wild type Cas9 (Cas9–2A-GFP) was obtained from Addgene (#44719). Chimeric guide RNA expression cassettes with different small guide RNA, TP53_Up_sgRNA: 5’- CCATTGTTCAATATCGTCCG −3’ and TP53_Down_sgRNA: 5’- GGGCAGCTACGGTTTCCGTC −3’ were ordered as gBlock. These gBlocks were amplified by PCR using primers: gBlock_Amplifying_F: 5’-TGTACAAAAAAGCAGGCTTTAAAGG-3’ and gBlock_Amplifying_R: 5’-TAATGCCAACTTTGTACAAGAAAGC-3’. The PCR product was purified by Agencourt Ampure XP PCR Purification beads according to manufacturer’s protocol (Beckman Coulter). 1.5 μg of Cas9 plasmid and 0.5 μg of each gRNAgBlock were co-transfected into hESCs via Lipofectamine 3000 (Thermo Fisher Scientific). For TP53-KO hESCs, the transfected cells were cultured in TeSR-E8 medium with 1 μM Nutlin-3a for one week. For TP53-KO RKO cells, single clones were picked up and validated by PCR and Western blotting.

Liu C., Banister C.E, & Buckhaults P.J. (2019). Spindle assembly checkpoint inhibition can resensitize p53-null stem cells to cancer chemotherapy. Cancer research, 79(9), 2392-2403.

+ Open protocol

+ Expand

Generation of Fluorescent hESC Line

Check if the same lab product or an alternative is used in the 5 most similar protocols

hES cells (H1 (WA01), WiCell) were electroporated with a plasmid containing an AAVS1-targeting sgRNA and Cas9-2A-GFP (Addgene Plasmid #38138) and a second donor template plasmid containing a splice acceptor with puromycin for selection from the endogenous AAVS1 expression, a constitutively expressed tdTomato using the CAGGS promoter, and 800-900 bp homology arms for the AAVS1 locus flanking the sgRNA targeting cut site. Electroporations were done using a 4D nucleofector (Lonza) according to the manufacturer’s instructions and 1:4 molar ratio of Cas9 to donor template plasmid. After electroporation, cells were plated in a 10 cm Matrigel-coated dish and allowed to recover for 3 days. After recovery, cells were selected with puromycin from the endogenous AAVS1 expression for 5 days at 1 μ/mL to generate pure tdTomato-positive hESCs.

Silva I.R., Smyth T.J., Moxley D.F., Carter T.E., Allen N.S, & Rufty T.W. (2000). Aluminum Accumulation at Nuclei of Cells in the Root Tip. Fluorescence Detection Using Lumogallion and Confocal Laser Scanning Microscopy. Plant Physiology, 123(2), 543-552.

+ Open protocol

+ Expand

Generation of AAVS1-pur-CAG-hM4Di-mCherry Donor Plasmid

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human codon-optimized Streptococcus pyogenes wild-type Cas9 (Cas9-2A-GFP) and sgRNA T2 were obtained from Addgene (plasmid #44719, plasmid#41818)^{53 (link),54 (link)}. To generate AAVS1-pur-CAG-EGFP donor plasmid, we replaced the hrGFP gene in the AAVS1-pur-CAG-hrGFP plasmid (Addgene plasmid #52344)^{55 (link)} with EGFP gene and inserted woodchuck hepatitis post-transcriptional regulatory element (WPRE) and human growth hormone (hGH) Poly A into the 3’ terminal of EGFP gene to obtain AAVS1-pur-CAG-EGFP donor plasmid. We next amplified hM4Di-mCherry cDNA by PCR from AAV-DIO-hM4Di-mCherry plasmid (a gift from Dr. Bryan L. Roth), respectively. hM4Di-mCherry was inserted into the AAVS1-pur-CAG-EGFP donor plasmid to replace EGFP to get the AAVS1-pur-CAG-hM4Di-mCherry donor plasmid.

Upadhya D., Attaluri S., Liu Y., Hattiangady B., Castro O.W., Shuai B., Dong Y., Zhang S.C, & Shetty A.K. (2022). Grafted hPSC-derived GABA-ergic interneurons regulate seizures and specific cognitive function in temporal lobe epilepsy. NPJ Regenerative Medicine, 7, 38.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!