Hotstartaq buffer

Manufactured by Qiagen

Sourced in United States, France

HotStarTaq buffer is a specialized buffer solution used in the preparation of DNA samples for PCR (Polymerase Chain Reaction) amplification. It is designed to provide optimal conditions for the activity of the HotStarTaq DNA polymerase enzyme.

Automatically generated - may contain errors

Lab products found in correlation

Hotstar taq polymerase, by Qiagen (9 mentions) Pyrogold sqa reagent kit, by Qiagen (3 mentions) Hotstartaq, by Qiagen (3 mentions) Hotstartaq dna polymerase, by Qiagen (2 mentions) Pyromark software, by Qiagen (1 mentions) Qiaquick pcr purification kit, by Qiagen (1 mentions) Shrimp alkaline phosphatase, by Labcorp (1 mentions) Typer software, by Labcorp (1 mentions) Massarray system, by Labcorp (1 mentions) Epitect 96 bisulfite kit, by Qiagen (1 mentions) Qcpg software, by Biotage (1 mentions) 454 gs flx instrument, by Roche (1 mentions) Exonuclease 1 exo 1, by Illumina (1 mentions) Snapshot multiplex kit, by Thermo Fisher Scientific (1 mentions) Primer mix, by Qiagen (1 mentions) Genemapper 4, by Thermo Fisher Scientific (1 mentions) Hot firepol taq, by Solis BioDyne (1 mentions) 3730 dna analyzer, by Thermo Fisher Scientific (1 mentions) Puregene dna extraction kit, by Qiagen (1 mentions) Phusion u hot start, by Thermo Fisher Scientific (1 mentions)

16 protocols using hotstartaq buffer

Genetic Profiling of Craniofacial Disorders

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA of the patients and their parents was extracted from peripheral blood following a standard protocol. All exons and the exon-intron borders of TCOF1, GSC, and HOXA2 were amplified by PCR under optimal conditions using specific primers (Table 1); the 1200-bp upstream of TCOF1 were also amplified.
A mixture with a total volume of 20 μL was prepared for each reaction including 1× HotStarTaq buffer, 2.0 mM Mg²⁺, 0.2-mM dNTP, 0.2 μM of each primer, 1 U HotStarTaq polymerase (Qiagen Inc), and 1-μL template DNA. The cycling program was 95°C for 15 minutes; 11 cycles of 94°C for 15 seconds, 62°C to 0.5°C per cycle for 40 seconds, and 72°C for 1 minute; 24 cycles of 94°C for 15 seconds, 54°C to 58°C for 30 seconds, and 72°C for 1 minute; and 72°C for 2 minutes. The PCR products were purified using SAP and ExoI. A mixture of 1 U SAP, 6 U ExoI, and 8-μL PCR products was incubated at 37°C for 60 minutes, followed by incubation at 70°C for 10 minutes. The reaction mixture included 2-μL BigDye 3.1 mix, 2-μL sequencing primer (0.4 μM), and 1- to 2-μL purified PCR product. The cycling program was 96°C for 1 minute followed by 28 cycles of 96°C for 10 seconds, 50°C for 5 seconds, and 60°C for 4 minutes. The final products were then analyzed using a capillary sequencer (ABI Prism 3730xl sequencing).

Hao S., Jin L., Wang H., Li C., Zheng F., Ma D, & Zhang T. (2016). Mutational Analysis of TCOF1, GSC, and HOXA2 in Patients With Treacher Collins Syndrome. The Journal of Craniofacial Surgery, 27(6), e583-e586.

+ Open protocol

+ Expand

Quantitative DNA Methylation Analysis by Pyrosequencing

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative DNA methylation analysis was performed by pyrosequencing of bisulfite-treated DNA as previously described [35 (link)]. Sequences including CpGs were amplified using 20 ng of bisulfite-treated human genomic DNA and 5–7.5 pmol of forward and reverse primer, one being biotinylated. Two pairs of PCR primers were designed for PCR1 (CpG 1, 2, 3 and 4) and PCR2 (CpG 5 and 6). PCR was designed around the hypermethylated probes from previous Illumination 450 k Bead Chip analysis [21 (link)].
PCR1: Biotin-TTTAGAGTTGGTGTTGGATATAGAA (Forward) and CCAAAACCAAAATAAAAATCTAAAC (Reverse);
PCR2: TTTAGATTTTTATTTTGGTTTTGGA (Forward) and Biotin-TATAATATCTCTCCATTTATCCCAATATCT (Reverse).
Reaction conditions were 1 × HotStar® Taq buffer (Qiagen) supplemented with 1.6 mM MgCl₂, 100 μM dNTPs and 2.0 U HotStar Taq polymerase (Qiagen) in a 25 μL volume. The PCR program consisted of a denaturing step of 15 min at 95 °C, followed by 50 cycles of 30 s at 95 °C, 30 s at 60 °C and 20 s at 72 °C, with a final extension of 5 min at 72 °C. A total of 10 μL of PCR product was rendered single-stranded as previously described and 4 pmol of the respective sequencing primers were used for analysis. Quantitative DNA methylation analysis was carried out on a PSQ 96MD system with the PyroGold SQA Reagent Kit (Qiagen) and results were analyzed using the PyroMark software (V.1.0, Qiagen).

Carrier A., Desjobert C., Lobjois V., Rigal L., Busato F., Tost J., Ensenyat-Mendez M., Marzese D.M., Pradines A., Favre G., Lamant L., Lanfrancone L., Etievant C., Arimondo P.B, & Riond J. (2022). Epigenetically regulated PCDHB15 impairs aggressiveness of metastatic melanoma cells. Clinical Epigenetics, 14, 156.

+ Open protocol

+ Expand

Molecular Detection of Borrelia burgdorferi

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR reactions were performed using primers designed to amplify B. burgdorferi sensu lato 16S ribosomal RNA small subunit. The 16S rRNA gene was amplified in a single reaction using primers F: 5′-CCTGGCTTAGAACTAACG-3′ and R: 5′-CCTACAAAGCTTATTCCTCAT-3′ in a 50-μl reaction containing HotStarTaq buffer (Qiagen) 1.5 mM MgCl₂, 25 pmoles of each primer, and 2.5 units of HotStarTaq DNA polymerase (Qiagen). The PCR reaction consisted of an initial denaturation at 94 °C for 15 min, followed by 40 cycles of 94 °C/30 s, 50 °C/30 s, 72 °C/1 min, and then a final extension at 72 °C/5 min. The PCR products were analyzed by standard agarose gel electrophoresis. PCR products were purified using the QIAquick PCR purification kit (Qiagen) according to the manufacturer’s instructions. Samples were eluted twice in 30 μl, and the eluates from each sample were pooled and sequenced in both directions twice (4× coverage) using the same primers that generated the products. All DNA sequencings were performed by Eurofins/MGW/Operon (Huntsville, AL).

Sapi E., Balasubramanian K., Poruri A., Maghsoudlou J.S., Socarras K.M., Timmaraju A.V., Filush K.R., Gupta K., Shaikh S., Theophilus P.A., Luecke D.F., MacDonald A, & Zelger B. (2016). Evidence of In Vivo Existence of Borrelia Biofilm in Borrelial Lymphocytomas. European Journal of Microbiology & Immunology, 6(1), 9-24.

+ Open protocol

+ Expand

Multiplex Genotyping with iPLEX Gold

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotyping was performed using the iPLEX gold method. We used iPLEX reagents, protocols for multiplex PCR, single-base primer extension (SBE) and generated mass spectra as per the manufacturer’s instructions. Multiplexed PCR was performed in 5 μl reactions on 96-well plates containing 10 ng of genomic DNA. Reactions contain 0.5 U HotStar Taq polymerase (Qiagen, CA, USA), 100 nM primers, 1.25X HotStar Taq buffer, 1.625 mM MgCl2 and 500 μM dNTPs. Following enzyme activation at 94°C for 15 min, DNA was amplified with 45 cycles of 94°C × 20 s, 56°C × 30 s, 72°C × 1 min, followed by a 3-min extension at 72°C. Unincorporated dNTPs were removed using shrimp alkaline phosphatase (0.3 U, Sequenom, CA, USA). SBE was carried out by addition of SBE primers at concentrations from 0.625 (low molecular weight [MW] primers) to 1.25 μM (high MW primers) using iPLEX enzyme and buffers (Sequenom) in 9-μl reactions. Reactions were desalted and SBE products measured using the MassARRAY system, and mass spectra analyzed using TYPER software (Sequenom), in order to generate genotype calls and allele frequencies.

Roman Y.M., Culhane-Pera K.A., Menk J, & Straka R.J. (2016). Assessment of genetic polymorphisms associated with hyperuricemia or gout in the Hmong. Personalized medicine, 13(5), 429-440.

+ Open protocol

+ Expand

Genetic Analysis of IDUA Gene in MPS I

Check if the same lab product or an alternative is used in the 5 most similar protocols

We analyzed the IDUA gene of 4 MPS I patients from Northern Tunisia using PCR, PCR-based restriction fragment length polymorphism (RFLP) and direct sequencing methods.
Genomic DNA was isolated from venous blood by the phenol/chloroform procedure according to standard protocols as described previously [8 ]. All the exons and flanking intron/exon junctions of the IDUA gene were amplified and sequenced. For patients with a family history of known or suspected pathogenic mutations or for the indexed cases of parents, the targeted DNA locus was analyzed.
PCR reaction consisted of 50 ng of DNA,1 X HotStarTaq buffer (Qiagen, Paris, France), 2 mM MgCl2, 200 μM of each dNTP, 10 pmol of each primer, 2.5 U of HotStarTaq (Qiagen, Paris, France) and 1 X Q solution. The final reaction volume was 18 μl. Thermal PCR profile consisted of an initial denaturation at 95 °C for 15 min, 35 cycles of denaturation at 94 °C for 30s, annealing at 68 °C for 30s and extension at 72 °C for 30s followed by a final extension step at 72 °C for 10 min. PCR products were resolved in 2% agarose gel and were visualized under UV light.

Chkioua L., Boudabous H., Jaballi I., Grissa O., Turkia H.B., Tebib N, & Laradi S. (2018). Novel splice site IDUA gene mutation in Tunisian pedigrees with hurler syndrome. Diagnostic Pathology, 13, 35.

+ Open protocol

+ Expand

Quantitative DNA Methylation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative DNA methylation analysis was performed by pyrosequencing of bisulfite treated DNA [53 (link)]. One μg of DNA was bisulphite converted using the EpiTect 96 Bisulfite kit (Qiagen) according to the manufacturer's instructions. Regions of interest were amplified using 30 ng of bisulfite treated human genomic DNA and 5 to 7.5 pmol of forward and reverse primer, one of them being biotinylated. Sequences for oligonucleotides for PCR amplification and pyrosequencing are given in supplementary Materials (available online). Reaction conditions were 1x HotStar Taq buffer supplemented with 1.6 mM MgCl2, 100 μM dNTPs and 2.0 U HotStar Taq polymerase (Qiagen) in a 25 μl volume. The PCR program consisted of a denaturing step of 15 min at 95°C followed by 50 cycles of 30 s at 95°C, 30 s at the respective annealing temperature and 20 s at 72°C, with a final extension of 5 min at 72°C. Ten μl of PCR product were rendered single-stranded as previously described [53 (link)] and 4 pmol of the respective sequencing primer were used for analysis. Quantitative DNA methylation analysis was carried out on a PSQ 96MD system with the PyroGold SQA Reagent Kit (Qiagen) and results were analyzed using the Q-CpG software (V.1.0.9, Biotage AB).

Djaafri I., Khayati F., Menashi S., Tost J., Podgorniak M.P., Sadoux A., Daunay A., Teixeira L., Soulier J., Idbaih A., Setterblad N., Fauvel F., Calvo F., Janin A., Lebbé C, & Mourah S. (2014). A novel tumor suppressor function of Kindlin-3 in solid cancer. Oncotarget, 5(19), 8970-8985.

+ Open protocol

+ Expand

DNA Digestion and Sequencing Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Purified genomic DNA was processed as previously described (Varley and Mitra 2010 (link)), with the following modifications. Genomic DNA (500 ng) was digested in a 20-μL reaction containing 10 units R.AluBI, manufacturer-provided buffer, and acetylated bovine serum albumin. Reactions were incubated for 3 h at 37°C then heat inactivated for 20 min at 65°C. The patch oligonucleotide hybridization and ligation reaction was carried out as described except that the right U2 capture oligonucleotide that contains a 3-carbon spacer was also synthesized with five phosphorothioate bonds to further protect target loci from exonuclease digestion. Reactions were treated with exonucleases and bisulfite converted as described (Varley and Mitra 2010 (link)). Amplification of target loci was carried out in 50-μL reactions with the following components: all recovered bisulfite-converted DNA (10 μL), 1× HotStarTaq buffer (Qiagen), 500 μM MgCl₂, 50 μM each dNTP, 250 nM each barcoded primer, and 10 units HotStarTaq DNA polymerase (Qiagen). Reaction products were pooled and PCR purified, then gel purified. Purified products were sequenced at the University of Florida Interdisciplinary Center for Biotechnology Research using the Roche 454 GS FLX+ instrument according to manufacturer protocols.

Nabilsi N.H., Deleyrolle L.P., Darst R.P., Riva A., Reynolds B.A, & Kladde M.P. (2014). Multiplex mapping of chromatin accessibility and DNA methylation within targeted single molecules identifies epigenetic heterogeneity in neural stem cells and glioblastoma. Genome Research, 24(2), 329-339.

+ Open protocol

+ Expand

Molecular Characterization of M. genitalium

Check if the same lab product or an alternative is used in the 5 most similar protocols

23S rRNA gene sequencing of the 23S ribosomal RNA gene from 16 M. genitalium positive samples was performed as described previously [11 (link)]. The gene was amplified using F1-Mg (5′ GAAGGAGGTTAGCAATTTATTGC) and R1-Mg (5′ TTCTCTACATGGTGGTGTTTTG) and HotStar Taq (12.5 μl HotStar Taq Buffer (Qiagen), 1 μM each primer, 5 μl extracted DNA, in a 30 μl reaction). Sequencing was performed with PCR amplification primers and yielded around 150 nt sequence. Cycling conditions were 95 °C for 15 min and then 45 cycles of 94 °C for 15 s, 58 °C for 30 s, 72 °C for 30 s and a final elongation of 3 min at 72 °C. Sequences (GenBank accession MK411350-MK411365) were manually checked for the presence of alterations at nucleotide 2058 or 2058 (E. coli numbering).
GyrA or parC sequencing was carried out as previously described [12 (link)] using either MG-GYRA-A (CGTCGTGTTCTTTATGGTGC) and MG-GYRA-B (ATAACGYYGTGCAGCAGGTC) primers or MG-PARC-A (TGGGCTTAAAACCCACCACT) and MG-PARC-B (CGGGTTTCTGTGTAACGCAT). HotStar Taq was again used, with 10 μM each primer and 5 μl extracted DNA (total 30 μl volume) and cycling was as for 23S rRNA sequencing. Comparison of the resulting 150 nucleotide sequences (GenBank accession MK411366- MK411397) with previously published mutations was through manual alignment.

Hart T., Tang W.Y., Mansoor S.A., Chio M.T, & Barkham T. (2020). Mycoplasma genitalium in Singapore is associated with Chlamydia trachomatis infection and displays high macrolide and Fluoroquinolone resistance rates. BMC Infectious Diseases, 20, 314.

+ Open protocol

+ Expand

Genotyping Pharmacogenetic Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

The sequences of the CYP2C19, ABCB1, and PON1 genes were retrieved from the NCBI database (http://www.ncbi.nlm.nih.gov). The PCR primers of CYP2C19 (rs4244285, rs4986893), PON1 (rs662) SNPs, and ABCB1 (rs1045642) were designed by Primer 5.0 software (Table 1) and synthesized by Shanghai Genesky Biotech Co., Ltd. The PCR reaction materials (10 μL) included 1×HotStar Taq buffer, 3.0 mM Mg²⁺, 0.3 mM dNTP, 1 U HotStar Taq polymerase (Qiagen Inc.), 1 μL sample DNA, and 1 μL PCR primer (1 μM). Restriction endonuclease reaction system (10 μL) contained 1x buffer, 1 U of restriction endonuclease, and 4 μL of PCR product. The reaction was conducted in a water bath at an appropriate temperature. Restriction enzyme digestion using the MspI, BamHI, BfuCI, and BfuCI restriction enzymes for CYP2C19 (rs4244285, rs4986893), ABCB1 (rs1045642), and PON1 (rs662) polymorphisms, respectively. Genotypes were analyzed based on the length of the products after gel electrophoresis (Table 1).

Su Q., Li J., Tang Z., Yang S., Xing G., Liu T, & Peng H. (2019). Association of CYP2C19 Polymorphism with Clopidogrel Resistance in Patients with Acute Coronary Syndrome in China. Medical Science Monitor : International Medical Journal of Experimental and Clinical Research, 25, 7138-7148.

+ Open protocol

+ Expand

Multiplex SNP Genotyping Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

As showed in Table 1, a total of 7 pairs of PCR primers were designed to amplify seven 122-250 bp fragments each containing a specific locus, and seven extension primers adjacent to the single nucleotide polymorphism (SNP) loci were used for single base extension. PCR products were obtained from multiple PCR reactions using HotStarTaq (Qiagen), after purification using shrimp alkali enzyme (SAP; Promega) and exonuclease I (EXO I) (Epicentre). The PCR products then underwent an extension reaction using SNaPshot Multiplex kit (ABI), and the extension products were purified using Promega SAP in an ABI3130xl sampler. The SNP genotyping results were read using GeneMapper 4.1. PCR reactions were performed in 10 µL reaction volumes containing 1× HotStar Taq buffer, 3.0 mM Mg²⁺, 0.3 mM dNTP, 1 U HotStar Taq Polymerase (Qiagen), 1 µL sample DNA, and 1 µL multiplex PCR primers. PCR cycling conditions were as follows: 95 °C for 2 min; followed by 11 cycles of 94 °C for 20 s, 65 °C (-0.5 °C/cycle) for 40 s, and 72 °C for 90 s; 24 cycles of 94 °C for 20 s, 59 °C for 30 s, and 72 °C for 90 s; and 72 °C for 120 s. Samples were then cooled to 4 °C when reactions were complete. PCR products were purified using 5U SAP and 2U Exonuclease I in 15 µL PCR product, incubated at 37 °C for 1 h, and then inactivated at 75 °C for 15 min.

LIU L., CHEN L., LI Z., LI L., QU J, & XUE J. (2014). Association between Gene Polymorphisms of Seven Newly Identified Loci and Type 2 Diabetes and the Correlate Quantitative Traits in Chinese Dong Populations. Iranian Journal of Public Health, 43(10), 1345-1355.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!