Alumina slurries

Manufactured by Buehler

Sourced in United States

Alumina slurries are aqueous suspensions of aluminum oxide (Al2O3) particles. They are primarily used as polishing and lapping media in various industrial applications, such as the manufacturing of electronic components, optical lenses, and other precision surfaces. Alumina slurries provide a controlled and consistent abrasive action for the removal of material from the surface being processed.

Automatically generated - may contain errors

Lab products found in correlation

8 protocols using alumina slurries

Enzyme-Mediated Electrochemical Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Acetone (propanone; 99%; b.p. 56 °C) and methylethylketone (butanone; 99%, b.p. 79 °C) were purchased from Pronalab. The remaining chemicals were of analytical grade and were used without further purification. Solutions were prepared with deionized (DI) water (18 MΩ cm) from a Millipore MilliQ purification system.
Glucose oxidase (Type II from Aspergillus niger 17.3 U mg⁻¹) and catalase (from bovine liver, 2–5 kU mg⁻¹) were purchased as lyophilized powders from Sigma and used as received. ccNiR (in 0.05 M phosphate buffer, pH 7.6) was purified from D. desulfuricans ATCC 27774 cells grown in a nitrate containing medium, as described in Ref. [23 (link)]. The specific activity was 300 U mg⁻¹ (1 U–1 μmol nitrite reduced per minute), the turnover number was 340 s⁻¹ (20 °C) and the protein concentration was 3.0 mg mL⁻¹.
The graphite conductive ink was obtained from Acheson. Alumina slurries (0.05 and 1.0 μm) were purchased from Buehler.

Monteiro T., Rodrigues P.R., Gonçalves A.L., Moura J.J., Jubete E., Añorga L., Piknova B., Schechter A.N., Silveira C.M, & Almeida M.G. (2015). Construction of effective disposable biosensors for point of care testing of nitrite. Talanta, 142, 246-251.

+ Open protocol

+ Expand

Aptamer-Antibody Biosensor for LDL Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Apolipoprotein B monoclonal antibody (AbM-anti-apoB) was purchased from Invitrogen (Poland). Aptamer specific to LDL antigen (Apt-LDL)—ssDNA sequence of
5′-ACCTCGATTTTATATTATTTCGCTTACCAACAACTGCAGA-3′ with 3′-SH group modification was synthesized by Biomers (Germany). 4-aminothiophenol (ATP), N-(3-Dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC), N-Hydroxysuccinimide (NHS), bovine serum albumin (BSA), phosphate buffer saline tablets: 0.01 M phosphate buffer, 0.0027 M potassium chloride, and 0.137 M sodium chloride, pH 7.4 at 25 °C (PBS), 6-mercapto-1-hexanol (6MHol), low density lipoprotein (LDL), human serum albumin (HSA), 4-mercaptobenzoic acid (4-MBA), K₂Fe(CN)₆, K₃Fe(CN)₆, were purchased from Sigma-Aldrich (Poznań, Poland). High density lipoprotein (HDL) was obtained From Merck (Germany). Malondialdehyde-modified low density lipoprotein (MDA-LDL) was acquired from Cell Biolabs, inc. (San Diego, CA, USA). H₂SO₄, KOH, ethanol, methanol were purchased from POCH (Poland). Alumina slurries: 0.3 and 0.05 µm were obtained from Buehler (Lake Bluff, IL, USA). Deionized water (resistivity of 18.2 MΩ cm) obtained with a Mili-Q reagent grade system produced by Millipore (Bedford, MA, USA) was used for preparation of all aqueous solutions. Human blood serum was obtained from Sigma-Aldrich. Mixed samples were aliquoted and stored at −20 °C until used.

Rudewicz-Kowalczyk D, & Grabowska I. (2021). Detection of Low Density Lipoprotein—Comparison of Electrochemical Immuno- and Aptasensor. Sensors (Basel, Switzerland), 21(22), 7733.

+ Open protocol

+ Expand

Aptamer-Based RBP-4 Detection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

MCH, K₃[Fe(CN)₆] and K₄[Fe(CN)₆], PBS buffer and MgCl₂ were purchased from Sigma-Aldrich (Poznan, Poland). Potassium hydroxide, sulfuric acid, ethanol and methanol were obtained from POCh (Gliwice, Poland). Alumina slurries with particle sizes of 0.3 and 0.05 µm were produced by Buehler (Lake Bluff, IL, USA). The Apt-RBP-4 sequence of: 5’-ACA GTA GTG AGG GGT CCG TCG TGG GGT AGT TGG GTC GTG G-3’, functionalized with a thiol group (-SH) at its 5’-end, was purchased from Biomers (Ulm, Germany). The aptamer sequence was taken from a paper by Lee and co-workers. RBP-4 was obtained from Abcam (ab111460). Vaspin (SRP4915) and adiponectin (SRP4901) were purchased from Sigma-Aldrich. All aqueous solutions were prepared with deionized and charcoal-treated water (resistivity of 18.2 MΩ cm) filtered with a Milli-Q reagent-grade water system (Millipore, Bedford, MA, USA). Before each measurement, all solutions were purged with nitrogen (ultrapure 6.0, Air Products, Warsaw, Poland) for 10 min in order to remove oxygen.

Malecka-Baturo K., Żółtowska P., Jackowska A., Kurzątkowska-Adaszyńska K, & Grabowska I. (2024). Electrochemical Aptasensing Platform for the Detection of Retinol Binding Protein-4. Biosensors, 14(2), 101.

+ Open protocol

+ Expand

Electrochemical Aptasensor for Tetracycline Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tetracycline hydrochloride (TET), oxyTetracycline hydrochloride (OTC), doxycycline hydrochloride (DOX), 6-mercaptohexan-1-ol (MCH), sodium perchlorate (NaClO₄), and sodium phosphate (Na₂HPO₄) were purchased from Sigma-Aldrich (Poznań, Poland). Potassium hydroxide, sulphuric acid, ethanol, and methanol were obtained from POCh (Gliwice, Poland). Alumina slurries with particle sizes of 0.3 µm and 0.05 µm were ordered from Buehler (Lake Bluff, IL, USA). The TET binding aptamer modified with ferrocene (Fc) HS-Apt-Fc:
5′–Fc–CCCCCGGCAGGCCACGGCTTGGGTTGGTCCCACTGCGCGT–(CH₂)₃–SH–3′, used as a probe, was synthesized by Biomers (GmbH, Germany). Commercially available UHT cow’s milk with 1.5% fat content was used as a natural matrix.
All electrochemical measurements and steps of aptasensor preparation were performed using a buffer containing 0.1 M NaClO₄ & 2.5 mM Na₂HPO₄, pH 7.0.
All aqueous solutions were prepared with deionized and charcoal-treated water (resistivity of 18.2 MΩ/cm) purified with a Milli-Q reagent-grade water system (Millipore, Bedford, MA). All solutions were deoxygenated by purging with nitrogen (ultra-pure 6.0, Air Products, Warsaw, Poland) for 20 min.

Malecka-Baturo K., Zaganiaris A., Grabowska I, & Kurzątkowska-Adaszyńska K. (2022). Electrochemical Biosensor Designed to Distinguish Tetracyclines Derivatives by ssDNA Aptamer Labelled with Ferrocene. International Journal of Molecular Sciences, 23(22), 13785.

+ Open protocol

+ Expand

Electrochemical Characterization of Platinum Electrode

Check if the same lab product or an alternative is used in the 5 most similar protocols

Electrochemical experiments were performed on a Gamry Potentiostat Interface 1000 controlled with software PHE 200 and PV 220. All measurements were carried out in a single-compartment electrochemical cell with a standard three-electrode arrangement. A platinum disk with an area of 0.72 cm² and a platinum wire were used as the working and the counter electrodes, respectively. The working electrode was successively polished with 1.0, 0.3 and 0.05 μm alumina slurries (Buehler) on microcloth pads (Buehler). After each polishing, the electrode was washed with water and sonicated for 10 min in acetonitrile. Then, it was immersed into a hot piranha solution (3:1, H₂SO₄, 30% H₂O₂) for 10 min, and rinsed copiously with water. All potentials were reported versus Ag/AgCl/KCl (3.0 M) reference electrode (BAS Model MF-2078) at room temperature. The electrolyte solutions were degassed with purified nitrogen for 10 min before each experiment and bubbled with nitrogen during the experiment. Operating conditions for SWV were pulse amplitude 25 mV, frequency 10 Hz, potential step 4 mV; and for DPV were pulse amplitude 50 mV, pulse width 50 ms, scan rate 100 mV/s.

Yilmaz B., Kaban S, & Akcay B.K. (2015). Anodic Oxidation of Etodolac and its Linear Sweep, Square Wave and Differential Pulse Voltammetric Determination in Pharmaceuticals. Indian Journal of Pharmaceutical Sciences, 77(4), 413-421.

+ Open protocol

+ Expand

Elemental Analysis of Polished Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

EDS analysis identified and quantified the chemical elements in the sample using energy emission from excited atoms and ions. The slices for analyses in EDS and SEM were fixed in acrylic resin and polished with decreasing granulations of sandpaper (#600 and #1,200) and wet polishing cloth in synthetic fiber (Buehler Brazil, São Paulo, SP, Brazil) with 0.3-μm and 0.05-μm alumina slurries (Buehler Brazil) [12 (link)]. The surface was then analyzed using SEM with EDS coupled detector (EVO 50; Carl Zeiss, Cambridge, England) under an interface magnification of ×1,000.
Dehydration was performed by immersing specimens in ethanol at concentrations of 25%, 50%, 75%, and 95% for 20 minutes in each solution and 60 minutes in 100% ethanol. The specimens were fixed again in metallic stubs and covered with a thin layer of gold-palladium alloy (Bal-Tec SCD 005 Sputter Coater, Balzers, Liechtenstein) [12 (link)]. The adhesive interface was scanned, and the most representative area of each group was photographed at different magnifications.

Ziotti I.R., Paschoini V.L., Corona S.A, & Souza-Gabriel A.E. (2022). Chitosan-induced biomodification on demineralized dentin to improve the adhesive interface. Restorative Dentistry & Endodontics, 47(3), e28.

+ Open protocol

+ Expand

Electrochemical Characterization of Microdisc

Check if the same lab product or an alternative is used in the 5 most similar protocols

The electrochemical cell consists of three electrodes; a carbon microdisc working electrode (diameter = 7 μm, IJ Cambria Scientific Ltd, UK), a saturated mercury sulphate reference electrode MSE (ALS, Japan) and a carbon rod counter electrode. The electrochemical experiments were conducted with a computer controlled potentiostat (Bio-Logic SP200, France). The working electrode was cleaned after each experiment using alumina slurries of decreasing particle sizes: 1.0, 0.3 and 0.05 μm (Buehler, LakeBluff, IL, USA). All electrochemical experiments were thermostated at 25 °C.

Yang M., Rasche B, & Compton R.G. (2019). Acoustic cavitation generates molecular mercury(ii) hydroxide, Hg(OH)2, from biphasic water/mercury mixtures †Electronic supplementary information (ESI) available: Experimental scheme, spike analysis and particle characterisation. See DOI: 10.1039/c9sc04743c. Chemical Science, 11(2), 556-560.

+ Open protocol

+ Expand

Electrochemical Sensing of Biomolecules

Check if the same lab product or an alternative is used in the 5 most similar protocols

Materials MoS 2 , K 3 [Fe(CN) 6 ], ascorbic acid, dopamine, uric acid, epinephrine, and sodium dodecyl sulfate (SDS) were obtained from Sigma-Aldrich. HNO 3 , HCl and H 2 SO 4 were obtained from Chempur. All chemicals used in this work were of analytical grade. Ultrapure water (Millipore) was used for preparation of solutions. The negatively charged CNP were obtained from Cabot. Positively charged CNP were prepared by earlier described procedure. 41 Polishing pad and alumina slurries were obtained from Buehler.

Dolinska J ., Chidambaram A ., Adamkiewicz W ., Estili M ., Lisowski W ., Iwan M ., Palys B ., Sudholter EJR ., Marken F ., Opallo M , & Rassaei L . (2016). Synthesis and characterization of porous carbon-MoS₂ nanohybrid materials: electrocatalytic performance towards selected biomolecules. Journal of materials chemistry. B, 4(8).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!