Ab267788

Tissues from 21 HCC patients who underwent surgical resection in Zhongshan Hospital were collected. Total RNA from tissues were extracted using the relevant purification kit (EZB, Suzhou, China). Reverse transcription and quantitative real-time PCR were conducted referring to the kit or the SYBR green mix (EZB, Suzhou, China) and the instructions of the PCR amplifier (Bio-Rad, CA, USA). The following primers were used for the genes indicated: β-actin, forward primer: GACTACCTCATGAAGATCCTCACC and reverse primer: TCTCCTTAATGTCACGCACGATT; PVR, forward primer: TGGAGGTGACGCATGTGTC and reverse primer: GTTTGGACTCCGAATAGCTGG. For immunohistochemistry, formalin-fixed paraffin-embedded sections (5 μm) were deparaffinized with xylene, rehydrated with a graduated series of ethanol, and rinsed with distilled water. After goat serum block, sections were stained with primary antibodies against PVR (ab267788, Abcam, Cambridge, UK) overnight, followed by incubation with the horseradish peroxidase-conjugated secondary antibody for 30 min at room temperature. Then, the sections were counterstained with hematoxylin.

Sorafenib (S1040, Selleck) was obtained from a reliable source and prepared as a stock solution. Recombinant human IL-22 (200-22, PeproTech) and antibodies for CD155 (ab267788, Abcam, UK), STAT3 (ab68153, Abcam, UK), p-STAT3(Y705) (ab267373, Abcam, UK), p-STAT3(S727) (ab219593, Abcam, UK), Ki-67 (GB13030-2, Servicebio, China), β-actin (ab6276, Abcam, UK) and GAPDH (ab8245, Abcam, UK) were obtained from reputable suppliers. Detailed information was available in Supplementary Table 1.