The regulatory segment of XdpR from the A. bohemicum R89-1 genome [19 ] was a short double-stranded DNA probe of 26 nucleotides obtained as complementary annealed primers (Fwd: CAATCATGATGATCGTCATGAATATA ) with the negative control mutated (Fwd: CAATTATGATGATCGTTATGAATATA ). The XdpR protein with an N terminal His tag was purified as described above for XdpB, concentrated to 0.5 mg/ml and preincubated with DNA (20 μM) for 1 h at room temperature. Electrophoretic separations were done in 7% PAGE gels in a blue native arrangement [29 (link)]. Precision plus protein All Blue Prestained protein standards (Bio Rad) and XdpR with 1% deoxycholate were used as markers. The gel was stained with ethidium bromide (1 μg/ml) in a TAE buffer for 2 h and destained for 30 min. Ethidium bromide fluorescence was recorded by MF-ChemiBIS 2.0 (DNR Bio-Imaging Systems).
Mf chemibis 2
Manufactured by DNR Bio-Imaging Systems
The MF-ChemiBIS 2.0 is a lab equipment product manufactured by DNR Bio-Imaging Systems. It is a chemiluminescence imaging system designed for the detection and analysis of chemiluminescent signals.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using mf chemibis 2
1
XdpR Protein Binding Assay
2
Investigating Protein Aggregation by SDS-PAGE
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A slab gel system (5 % stacking gel, 10 % separating gel) was used for SDS-PAGE analysis of MP samples. Both non-reductive and reductive (containing DTT) electrophoresis were performed to clarify the possible involvement of disulfide bonds in ultrasound-induced protein aggregation. The gel was stained by Coomassie brilliant blue (G-250) for 5 h and depigmented three times with distilled water. Images of the gels were obtained using a densitometer (MF-ChemiBIS 2.0, DNR Bio-Imaging Systems ltd. Israel).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!