The largest database of trusted experimental protocols

7 protocols using sigenome non targeting control sirna

1

DUSP4 Silencing and p38 Kinase in H/R

Check if the same lab product or an alternative is used in the 5 most similar protocols
The relationship between DUSP4 and the kinase activity of p38 in response to H/R treatment in RAECs was analyzed by using DUSP4 gene silencing. A rat DUSP4 siRNA kit (OriGene, Rockville, MD) was utilized at a dose of 10 nM, which was previously determined sufficient for silencing of at least 80% of the constitutively expressed DUSP4 72 h post transfection [28 (link)]. As a negative control, cells were transfected with siGENOME™ Non-Targeting Control siRNAs from GE Healthcare Dharmacon (Lafayette, CO). DUSP4 siRNA transfected cells were subjected to H/R experiments in conjunction with SB203580 pre-treatment and used to determine cell fate and molecular alterations in cells.
+ Open protocol
+ Expand
2

TRPM2 Silencing in ARPE-19 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
ARPE-19 cells were transfected with 50 nM siRNA against human TRPM2 (SMARTpool: SiGENOME TRPM2 siRNA, NCBI substance Id 152147430, GE Dharmacon, Lafayette, CO) using Lipofectamine 2000 (Invitrogen). Control experiments were performed by transfecting the SiGENOME non-targeting control siRNAs, Cat# D-001210-01-05, GE Dharmacon) or by exposing cells to Lipofectamine 2000 without siRNA. Analysis of protein content, Ca2+ imaging and survival assays were performed 24 h after transfection.
+ Open protocol
+ Expand
3

Autophagy and DENV Infection in Huh7.5 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Huh7.5 or GFP-LC3-Huh7.5 cells were seeded in a six-well plate with a density of 2 × 105 at 37 °C, 5% CO2 overnight. The condition of siRNA transfection followed the protocol from the Lipofectamine RNAiMAX transfection procedure (Invitrogen, Lipofectamine RNAiMAX Reagent, Carlsbad, CA, USA). The amounts of siRNA in each well were 20 pmol. Human TIM-1 siRNA (ON-TARGET plus siRNA pool, Dharmacon, L-019856-00-0005, Lafayette, CO, USA) (si-TIM-1) and human PI3KR1 siRNA (ON-TARGET plus siRNA pool, Dharmacon, L-003020-00-0005, Lafayette, CO, USA) (si-p85) are designed to target TIM-1 and p85 mRNAs, respectively. Non-targeting siRNAs (si-control) are negative control pool of four siRNAs designed and microarray tested for minimal targeting of human, mouse, or rat genes (siGENOME Non-Targeting Control siRNAs, Dharmacon, D-001810-10-05, Lafayette, CO, USA). After knockdown 48 h, the knockdown cells were removed with trypsin and were seeded in a new six-well plate for autophagy activation or DENV production and infectivity experiments.
+ Open protocol
+ Expand
4

Silencing TRIM41 in A549 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNAi target sequences (sense strand): TRIM41 siRNA #2: AAGGCGTGCTGTGGAAATAAA; TRIM41 siRNA #3: TTCAATAGGTGTGAAGAGGTA. siGENOME Non-Targeting Control siRNA (Dharmacon, # D-001210-02-05) was used as the control siRNA. Five pmol of siRNA duplexes were transfected into A549 cells using Lipofectamine RNAiMAX Transfection Reagent (Life Technologies) according to the manufacturer’s protocol.
+ Open protocol
+ Expand
5

Silencing SOX21 in Irradiated BV2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
On day 1, 1 × 105 BV2 cells were seeded in a culture medium in a six-well plate. On day 2, the cell medium was changed to Gibco opti-MEM reduced-serum medium (Thermo Fisher Scientific, MA, USA) and incubated for 2 h. siGENOME mouse SOX21 siRNA or siGENOME non-targeting control siRNA (Dharmacon, Lafayette, CO, USA) was mixed with 4 µL X-tremeGENE siRNA Transfection Reagent (Sigma-Aldrich Corporation, USA) for 15 min at room temperature. The mixture was then added to the cells in the six-well plate. After incubation for 5 to 6 h, the opti-MEM reduced-serum medium was replaced with DMEM medium. On day 3, the BV2 cells were exposed to 5 Gy gamma irradiation. On day 4, the cells were harvested for experiments.
+ Open protocol
+ Expand
6

Breast Cancer Cell Line Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human breast adenocarcinoma cell lines, MCF7 cells and MDA-MB-231 cells were purchased from American Type Culture Collection (ATCC). Each cell line was maintained in DMEM supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, and 1% penicillin/streptomycin. Transfection reagent, Effectene or lipofectamine 3000 was from Qiagen, Inc. (Valencia, CA) or Invitrogen (Grand Island, NY), respectively. ON-TARGETplus SMARTpool MMP9 siRNA and siGENOME Non-targeting control siRNA was from GE Dharmacon (Lafayette, CO). Lipopolysaccharide and b-actin antibody was purchased from Sigma (St. Louis, MO). Antibodies against p-p38 (Thr180/Tyr182), p-JNK (Thr183/Tyr185), p-ERK1/2 (Thr202/Tyr204) and p-IkBa (Ser-32) were from Cell Signaling Technology, Inc. (Beverly, MA). Antibodies against TOPK, TLR4, MMP9 or p-serine/threonine, and breast cancer tissue array paired with metastatic tumors or MMP9 inhibitor were purchased from Abcam (Cambridge, MA). Luciferase assay system was from Promega (Madison, WI). IkBa antibody or protein A/G plus-agarose bead was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). TOPK inhibitor, HI-TOPK-032 was from R&D system (Minneapolis, MN). SuperScript III reverse transcriptase was from Invitrogen (Grand Island, NY). GST-IkBa protein was from EMD Millipore (Billerica, MA).
+ Open protocol
+ Expand
7

RNAi Silencing of Key Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNAi target sequences (sense strand): PKP2 siRNA #1: 5′- ACGGCTCATGTTAATGAGTTA-3′; PKP2 siRNA #2: 5′- TCCGTGGGCAACGGAAATCTT-3′; PKP2 siRNA #3: 5′-ATCCAGCGAAATGAATCTACA-3′. ZMPSTE24 siRNA: 5′-CAATCTATGCTGATTATAT-3′. EIF2B4 FlexiTube siRNA (Qiagen, # GS8890). TRIM41 FlexiTube siRNA (Qiagen, # GS90933). FKBP8 FlexiTube siRNA (Qiagen, # GS23770). siGENOME Non-Targeting Control siRNA (Dharmacon, # D-001210-02-05) was used as the control siRNA. siRNA duplexes were transfected into A549 (5 pmol) and primary tracheal cells (5 pmol) using Lipofectamine RNAiMAX Transfection Reagent (Life Technologies, # 13778030) according to the manufacturer's protocol.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!