Sp6 polymerase

For the northern blot assay, 5 µg total RNA was resolved by agarose gel electrophoresis, followed by transferring to a nylon membrane. The membrane was then subjected to UV crosslinking (120 mJ/cm²) immediately, followed by pre-hybridization for 1 h at 68 °C, and then hybridization with DIG labeled probes for 16 h at 68 °C. After blocking with the blocking buffer (Roche, 11585762001), the membrane was incubated with anti-DIG-AP antibody. The antisense probe was synthesized with the DIG RNA labeling Mix (Roche) and SP6 polymerase (Thermo). The antisense probe sequences are TCAGCTCTCTGCTCAAGTA and ACATGTTAAGCATACTGCGG for LETN, GAGAACGCCTGACACGCAGG and GCTGACACGCTGTCCTCT for Pre-rRNA, and CCGATCCACACGGAGTACTT and AGAAAATCTGGCACCACACC for beta-actin.

DNA templates for transcription reactions were generated by PCR using pSPUTK-Pgk1^{20 (link)} as a template. Reverse primers were designed such, that PCR products encoded different length PGK1 sequences, which all lacked a stop codon. The length of the resulting translation products, which remain ribosome-bound, is indicated in Results and Figure Legends. Transcripts were generated using SP6 polymerase (Thermo Fischer Scientific) as previously described^{55 (link)}. RNCs were generated via translation reactions primed with the stop codon-less transcripts at 20 °C in the presence of [³⁵S]-methionine (Hartmann-Analytic) for 80 min^{20 (link),54 (link)}. Translation reactions were stopped by the addition of 50 µg/ml cycloheximide final concentration and subsequently RNCs were isolated via centrifugation at 400.000 g for 20 min in a TLA-100 or TLA-100.2 rotor (Beckman Coulter)^{20 (link)}.

WISH was performed as described previously (Thisse and Thisse, 2008 (link)). Digoxigenin-labeled RNA probes were transcribed with T7, T3, or SP6 polymerase (Ambion). The probes were detected using alkaline phosphatase-coupled anti-digoxigenin Fab fragment antibodies (Roche) with BCIP/NBT staining (Vector Laboratories). The stained embryos were then photographed using a stereomicroscope (Nikon) equipped with a digital camera.