Platinum taq polymerase

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany, Australia, United Kingdom

Platinum Taq polymerase is a thermostable DNA polymerase used in polymerase chain reaction (PCR) applications. It is derived from the Thermus aquaticus bacterium and is designed to provide consistent and reliable DNA amplification performance.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Platinum PCR Taq DNA polymerase (3 citations) Super Script III One-Step RT-PCR System kit with Platinum Taq DNA polymerase (2 citations) Platinum™ II Taq Hot-Start DNA Polymerase kit (2 citations) Platinum Taq Polymerase Reagents (2 citations) Platinum Taq-HF polymerase (2 citations) SuperScript III platinum Taq polymerase (4 citations) Platinum Taq polymerase enzyme (3 citations) Platinum Pfx Taq Polymerase Kit (3 citations) Platinum Taq DNA Polymerase High Fidelity (5 U/μl) (2 citations) Master Mix Platinum®Taq DNA Polymerase (2 citations)

242 protocols using platinum taq polymerase

Nested PCR for DNA/HPV Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

The presence of DNA/HPV was detected using nested polymerase chain reaction (nested PCR) with the primer sets PGMY09/11 (first-round PCR) and GP + 5/GP + 6 (second-round PCR) using the Platinum™ Taq DNA Polymerase system (Invitrogen™, NY, USA) [11 (link)]. All samples were submitted for β-globin amplification.
The first-round mix was formed by 25 μL of the final volume, containing 10 pmol of each primer, 10X reaction buffer containing 1 mM MgCl2, 10 mM dNTP, 1 U of Taq Polymerase Platinum (Invitrogen), and 100 ng of genomic DNA [11 (link)]. The amplification cycles consisted of initial denaturation for 2 minutes at 95°C followed by 40 denaturation cycles for 40 seconds at 95°C, 40 seconds of annealing at 55°C, and 40 seconds of extension at 72°C.
The second-round (GP + 5/GP + 6) consisted of an initial denaturation at 95°C for 4 minutes followed by 45 cycles of denaturation at 95°C for 45 seconds, annealing at 40°C for 1 minute, and extension at 72°C for 1 minute. The reaction mix was formed by 25 μL of the final volume, containing 10 pmol of each primer, 10X reaction buffer, 1 mM of MgCl2, 10 Mm of dNTP, 2U of Taq Polymerase Platinum (Invitrogen), Milli-Q water, and 100 ng of genomic DNA [11 (link)].

Paula Almeida Cunha A., Kassandra Pereira Belfort I., Pedro Belfort Mendes F., Rodrigues Bastos dos Santos G., Henrique de Lima Costa L., de Matos Monteiro P., Lemos Gaspar R., Borges Ferreira M., de Sá Ferreira A., Cristina Moutinho Monteiro S, & Castello Branco Vidal F. (2020). Human papillomavirus and Its Association with Other Sexually Transmitted Coinfection among Sexually Active Women from the Northeast of Brazil. Interdisciplinary Perspectives on Infectious Diseases, 2020, 8838317.

+ Open protocol

+ Expand

SARS-CoV-2 D614G Mutation PCR Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR was performed using Platinum Taq polymerase (Invitrogen, Carlsbad, CA, USA). The reaction system contained 1 × Invitrogen PCR buffer with 4 mM MgCl₂, 200 μM of each dNTP, 0.5 U Platinum Taq polymerase, 0.4 μM of each primer (F and R), 1 μL of diluted synthesized DNA template (Table 4), and DNase/RNase-free water up to 20 μL. Thermal cycling procedure was 94°C for 2 min, 35 cycles at 94°C for 30 s, 50°C or indicated annealing temperature for 15 s and 72°C for 30 s. After amplification, 5 μL of PCR products were electrophoresed at 2% agarose gel under 90 V for 30 min and imaged in GelDoc XR Imaging System (Bio-Rad, Hercules, CA, USA).Table 4

Oligonucleotides synthesized as RT-PCR template.

Table 4

Name	Sequences (5’-3’)
D614-DNA	GTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGTTTATTCT
G614-DNA	GTTGCTGTTCTTTATCAGGGTGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGTT TATTCT
D614-RNA	GUUGCUGUUCUUUAUCAGGAUGUUAACUGCACAGAAGUCCCUGUUGCUAUUCAUGCAGAUCA ACUUA CUCCUACUUGGCGUGUUUAUUCU
G614-RNA	GUUGCUGUUCUUUAUCAGGGUGUUAACUGCACAGAAGUCCCUGUUGCUAUUCAUGCAGAUCA ACUUACUCCUACUUGGCGUGUUUAUUCU

Huang X., Zhang F., Zhu K., Lin W, & Ma W. (2021). dsmCRISPR: Dual synthetic mismatches CRISPR/Cas12a-based detection of SARS-CoV-2 D614G mutation. Virus Research, 304, 198530.

+ Open protocol

+ Expand

Quantifying gene expression in C. elegans

Check if the same lab product or an alternative is used in the 5 most similar protocols

Reverse transcription to form complementary DNA (cDNA) was performed using Superscript III (Invitrogen, 18080044). The obtained cDNA was used to perform qPCR by using SYBR Green I (Sigma, S9460) and Platinum Taq polymerase (Invitrogen, 10966034) in a BIO-RAD CFX96 real-time PCR machine (BIO-RAD, 1855196). The analysis of the results was performed by using the comparative C_T method^{82 (link)}.
All C. elegans qPCR experiments were done in biological triplicates, and the data were normalized to three housekeeping genes. qPCR C_T values were obtained using Bio-Rad CFX Manager 3.0.

Bujarrabal-Dueso A., Sendtner G., Meyer D.H., Chatzinikolaou G., Stratigi K., Garinis G.A, & Schumacher B. (2023). The DREAM complex functions as conserved master regulator of somatic DNA-repair capacities. Nature Structural & Molecular Biology, 30(4), 475-488.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were collected in PBS from the insert using cell-scrapers on ice. After centrifugation at 4 °C, 5000 rpm for 5 min, the cell pellet was lysed using TRIzol^TM reagent (Life Technologies, Rockville, MD, USA). RNA extraction was performed according to the TRIzol^TM Reagent protocol. RNA concentrations were measured using Nanodrop (Thermofisher Scientific). First strand cDNA synthesis was synthesized using MLV Reverse transcriptase (Sigma, M1302) with Oligo(dT) primers (self-designed: 23xT + 1 A, 23xT + 1 C and 23xT + 1 G). Quantitative RT-PCR analysis was performed with 0.5 µl of cDNA per reaction, Platinum Taq polymerase (Invitrogen, 18038042) and SybrGreen (Sigma, S9430). The primer combinations for the qRT-PCR are listed in Supplemental Table 3. Relative gene expression was calculated using the ∆∆CT method relative to GAPDH control.

Eenjes E., Mertens T.C., Buscop-van Kempen M.J., van Wijck Y., Taube C., Rottier R.J, & Hiemstra P.S. (2018). A novel method for expansion and differentiation of mouse tracheal epithelial cells in culture. Scientific Reports, 8, 7349.

+ Open protocol

+ Expand

Paramyxovirus Detection Using Seminested PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

For paramyxovirus detection, a broadly reactive seminested PCR assay specific for the RNA polymerase (L)- gene (538 bp) of the Paramyxovirinae subfamily was applied. 0 2 μl of cDNAs were amplified using the PAR primers designed by Tong et al. [43 (link)] and the protocol optimized with Taguchi method by Kurth et al. (36). Briefly for first round, the final concentration of the 25 μl reaction mix was: 0.1 mM deoxynucleoside triphosphates, 10 mM MgCl2, 0.12 μM of PAR F1 and PAR R primers and 1.25 U of Platinum Taq Polymerase (Invitrogen, Carlsbad, CA). The cycling conditions were 94 °C for 2 min, 40 cycles at 94 °C for 15 s, 50 °C for 30 s, 72 °C for 30 s and a final elongation step at 72 °C for 7 min. Then 1 μl first round PCR product was used in the second round with the same concentrations except for the MgCl_2, set up at 1 mM and the use of PAR F2 and PAR R primers, cycling parameters were identical to the first round.
PCR products (20 μl) were run and recovered from a 1.5% agarose gel, as described before.

Rizzo F., Edenborough K.M., Toffoli R., Culasso P., Zoppi S., Dondo A., Robetto S., Rosati S., Lander A., Kurth A., Orusa R., Bertolotti L, & Mandola M.L. (2017). Coronavirus and paramyxovirus in bats from Northwest Italy. BMC Veterinary Research, 13, 396.

+ Open protocol

+ Expand

SARS-CoV-2 RNA Detection from Saliva

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used 2.5 µL of RNA extracted from saliva in a reverse transcription assay using the SuperScript III Reverse Transcriptase kit (Invitrogen, Waltham, MA, USA) according to the manufacturer’s manual. The cycles of the two stages are 72 °C at 5 min (1st stage), thermal shock at 3 min (after thermal time), 50 °C at 10 min, 55 °C at 10 min, 58 °C at 58 min, and 94 °C at 1 min (2nd stage). For PCR reaction, 6 µL of reverse transcriptase reaction was used at a final volume of 25 µL. The enzyme used was Platinum Taq Polymerase from Brazil (Invitrogen, Massachusetts). The sequences of primers for the first and second rounds of amplification, shown in Table 1, were taken from published works [13 (link)] (https://github.com/artic-network/artic-ncov2019/blob/master/primer_schemes/nCoV-2019/V3/nCoV-2019.tsv accessed on 12 April 2021). The concentrations of all reagents used followed the guidelines of the enzymatic kits. The cycling of the first round is 94 °C for 2 min, 94 °C for 20 s, 60 °C for 30 s, 72 °C for 1 min and 30 s for 35 cycles, and 72 °C for 2 min. An amount of 2 uL of the first round was used for a second round PCR (Nested PCR) in a final volume of 60 uL, cycling at 94 °C for 2 min, 94 °C for 20 s, 60 °C for 30 s, 72 °C for 1 min and 10 s for 35 cycles and 72° for 2 min. At the end of the PCR, 10 uL of the product was used for electrophoresis in a 1.5% agarose gel.

Deminco F., Vaz S.N., Santana D.S., Pedroso C., Tadeu J., Stoecker A., Vieira S.M., Netto E, & Brites C. (2022). A Simplified Sanger Sequencing Method for Detection of Relevant SARS-CoV-2 Variants. Diagnostics, 12(11), 2609.

+ Open protocol

+ Expand

Rabies Virus N Gene Amplification and Sequencing

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The rabies virus N gene was amplified using the primers p1 and 304 using superscript III One-Step RT-PCR with Platinum Taq Polymerase (Invitrogen, Carlsbad, CA, USA), which generated an amplicon of 1,506 bp [44 (link)]. The amplified DNA products were visualized under UV transillumination after electrophoresis using SYBR Safe Gel (Invitrogen)-stained agarose gels. The PCR products of the discrepant samples were subjected to Sanger sequencing, and data analysis was conducted using MEGA X [45 (link)]. In addition to the aforementioned primer sets, a cocktail of JW6 DPL (Duvenhage virus PV and Lagos bat virus), JW6 M (Mokola virus), and JW6 E (EBLs 1 and 2) primers was used for sequencing [46 (link)]. To construct a phylogenetic tree, neighbor-joining phylogenetic analysis was performed using the Kimura-2 parameter in MEGA X. Bootstrap support was estimated for 1,000 replicates.

Kimitsuki K., Saito N., Yamada K., Park C.H., Inoue S., Suzuki M., Saito-Obata M., Kamiya Y., Manalo D.L., Demetria C.S., Mananggit M.R., Quiambao B.P, & Nishizono A. (2020). Evaluation of the diagnostic accuracy of lateral flow devices as a tool to diagnose rabies in post-mortem animals. PLoS Neglected Tropical Diseases, 14(11), e0008844.

+ Open protocol

+ Expand

Genotyping Protocols for Atp2a2 and Mb1-Cre Alleles

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

All mice were maintained on B6 background, and all animal protocols were approved by the Weill Cornell Institutional Animal Care and Use Committee or the University of Alabama at Birmingham Animal Resources Program. Atp2a2^flox (tm1c allele) mice were obtained from S. Kajimura (Ikeda et al., 2017 (link)). Genotyping was performed by PCR using Platinum Taq Polymerase (Invitrogen; 11304011) with the following primers: Atp2a2 Fwd: 5′-CACCTTGTTTAGCCTAGCTTTTTAC-3′; and Atp2a2 Rev: 5′-GTTGCACACTCTTTCTGTCCTG-3′. The PCR program is as follows: 94°C/2 min → [94°C/15 s → 58°C/30 s → 68°C/40 s] ×34 cycles → 68°C/3 min. The product size is 589 bp for WT and 700 bp for flox allele. To detect the knockout allele after crossing with Cre mice, a third primer (Atp2a2 3′LOXP.R1: 5′-ACTGATGGCGAGCTCAGACC-3′) was added together with the Fwd/Rev primer set. The product size for Cre-deleted allele is 200 bp.
Mb1-cre allele genotyping was performed using the above PCR conditions with the following primers: Mb1 Fwd: 5′-CTGCGGGTAGAAGGGGGTC-3′; Mb1 Rev: 5′-CCTTGCGAGGTCAGGGAGCC-3′; Mb1-Cre Fwd: 5′-ACCTCTGATGAAGTCAGGAAGAAC-3′; and Mb1-Cre Rev: 5′-GGAGATGTCCTTCACTCTGCTTCT-3′ (Yen et al., 2019 (link)). The expected product size is 400 bp for WT and 500 bp for the Cre allele.

Chen C.C., Chen B.R., Wang Y., Curman P., Beilinson H.A., Brecht R.M., Liu C.C., Farrell R.J., de Juan-Sanz J., Charbonnier L.M., Kajimura S., Ryan T.A., Schatz D.G., Chatila T.A., Wikstrom J.D., Tyler J.K, & Sleckman B.P. (2021). Sarco/endoplasmic reticulum Ca2+-ATPase (SERCA) activity is required for V(D)J recombination. The Journal of Experimental Medicine, 218(8), e20201708.

+ Open protocol

+ Expand

One-Step RT-PCR for E and GUSB Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The one-step reverse transcriptase reaction for the detection of the E gene was performed in a 25 μL reaction volume as described previously [2 ]. The assay was also performed in a 10 μL reaction volume, consisting of 5 μL 2× reaction buffer, 0.16 μL of a 50 mM magnesium sulfate solution and 0.40 μL of SuperScript™ III RT/Platinum™ Taq Mix (all provided by the SuperScript™ III One-Step RT-PCR with Platinum™ Taq Polymerase, Invitrogen, USA), 400 nM forward primer, 400 nM reverse primer, 200 nM probe (primers and probe provided by TIB MolBiol, Berlin, Germany), 0.4 μg of nonacetylated bovine serum albumin (Ultrapure™ BSA, Invitrogen, USA), and 2 μL of RNA.
The E-GUSB duplex RT-PCR was performed in a 25 μL and 10 μL reaction volume as described above, with the addition of 1.25 μL and 0.5 μL of the GUSB Gene Expression assay (Bio-Rad Laboratories, Hercules, CA), respectively.
All assays were performed on the LightCycler 480 II system (Roche Diagnostics) using the following cycling conditions: 10 min at 55 °C for reverse transcription, followed by 3 min at 95 °C, continuing with 15 s at 95 °C, and 30 s at 58 °C.

de Kock R., Baselmans M., Scharnhorst V, & Deiman B. (2020). Sensitive detection and quantification of SARS-CoV-2 by multiplex droplet digital RT-PCR. European Journal of Clinical Microbiology & Infectious Diseases, 40(4), 807-813.

+ Open protocol

+ Expand

Quantifying Reprimo Methylation by qMSP

Check if the same lab product or an alternative is used in the 5 most similar protocols

To quantify the methylation level of Reprimo, quantitative methylation-specific PCR (qMSP) was performed. Amplification reactions were carried out in triplicate in a volume of 20 μL that contained 1 μL of bisulfite-modified DNA; 300 nM of each primer; 50 nM probe (Table 1); 0.375 U platinum Taq polymerase (Invitrogen); 100 μM of dNTPs; 100 nM ROX dye reference (Invitrogen); 8.3 mM ammonium sulfate; 33.5 mM Trizma (Sigma, St. Louis, MO); 3.35 mM magnesium chloride; 5 mM mercaptoethanol; and 0.05 % DMSO [30 (link)]. Amplifications were carried out using the following profile: 95 °C for 10 min followed by 40 cycles at 95 °C for 30 s, 59 °C for 30 s and 72 °C for 30 s. Amplification reactions were carried out in 96-well plates in the Mx3000P QPCR System (Stratagene). Each plate included DNA samples, positive control (100 % methylated DNA, Zymo Research) and water blanks. The relative level of methylated DNA for RPRM was determined as a ratio of methylation-specific PCR-amplified gene to β-actin (reference gene) and then multiplied by 1000 for easier tabulation (average value of triplicates of the study gene divided by the average value of triplicates of β-actin × 1000) [30 (link), 31 (link)].

Buchegger K., Ili C., Riquelme I., Letelier P., Corvalán A.H., Brebi P., Huang T.H, & Roa J.C. (2016). Reprimo as a modulator of cell migration and invasion in the MDA-MB-231 breast cancer cell line. Biological Research, 49, 5.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!