Log In Sign up
The largest database of trusted experimental protocols

A spectrophotometer

Manufactured by Unico
Visit Supplier
Sourced in China, United States

A spectrophotometer is an instrument used to measure the intensity of light as a function of its wavelength. It is capable of detecting and quantifying the absorption or transmission of light by a sample, which can be used to analyze the chemical composition or properties of the sample.

Automatically generated - may contain errors

Lab products found in correlation

Mtt kit, by Beyotime (1 mentions) 7500 fast real time system, by Thermo Fisher Scientific (1 mentions) Primescript rt pcr kit, by Takara Bio (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Sybr premix ex taq, by Takara Bio (1 mentions)

7 protocols using a spectrophotometer

1

Measuring Chlorophyll Levels and Generating Transgenic Arabidopsis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chlorophyll levels were measured as described previously (Zhang et al., 2018) . In brief, chlorophyll was extracted from seedlings with 80% acetone in water, and the absorption of the extracted solutions was measured at 663 and 645 nm with a spectrophotometer (Unico). The chlorophyll concentration was calculated as (20.21 3 OD 663 + 8.02 3 OD 645 )/fresh weight.
Generation of the Transgenic Plants pCambia1300-Myc-gFHY1, pCambia1300-Myc-gFHY1 2KR , pCam-bia1300-GFP-gFHY1, pSuper-ASP1-GFP, pCambia1300-pPHYA-PHYA-GFP, and pCambia1300-psgR-Cas9-AtASP1 were introduced into Agrobacterium tumefaciens strain GV3101 and transformed into Arabidopsis plants using the floral dip method (Clough and Bent, 1998) .
Qu G.P., Li H., Lin X.L., Kong X., Hu Z.L., Jin Y.H., Liu Y., Song H.L., Kim D.H., Lin R., Li J, & Jin J.B. (2020). Reversible SUMOylation of FHY1 Regulates Phytochrome A Signaling in Arabidopsis. Molecular plant, 13(6).
+ Open protocol
+ Expand
2

Cell Viability Quantification by MTT Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
MTT kit (Beyotime, Shanghai, China) was utilized to detect the cell viability. In brief, cells were cultured for 48 hours at a density of 5000 cells per well. After that, each well was incubated for 4 hours with 10 μL MTT solution, and then incubated with 100 μL Formazan dissolving solution until the formazan precipitate was completely dissolved through the observation under an optical microscope. A spectrophotometer (Unico Instrument Co., Ltd., Shanghai, China) was adopted to measure the optical density (OD) value at 570 nm.
Dong J., Li L., Fang X, & Zang M. (2021). Exosome-Encapsulated microRNA-127-3p Released from Bone Marrow-Derived Mesenchymal Stem Cells Alleviates Osteoarthritis Through Regulating CDH11-Mediated Wnt/β-Catenin Pathway. Journal of Pain Research, 14, 297-310.
+ Open protocol
+ Expand
3

Evaluating Bacterial pH Tolerance

Check if the same lab product or an alternative is used in the 5 most similar protocols
The ability of isolate EA9 to withstand low pH levels was evaluated according to Nawaz et al. study [65 (link)]. The isolate was inoculated (1% v/v) into sterile MRS broth adjusted to several pH values (2, 3, 4, and 6.5) with 0.1 N HCl and incubated at 37 °C. The absorbance was measured at 620 nm using a spectrophotometer (Unico, Franksville, WI, USA) at hourly intervals for 6 h. The isolate EA9 was cultured at various pH levels to assess its capacity to resist low pH conditions, mimicking the pH of the stomach, which is estimated to be around 3 with a stay period of about 4 h.
Zaghloul E.H., Abuohashish H.M., El Sharkawy A.S., Abbas E.M., Ahmed M.M, & Al-Rejaie S.S. (2023). Probiotic Potential of the Marine Isolate Enterococcus faecium EA9 and In Vivo Evaluation of Its Antisepsis Action in Rats. Marine Drugs, 21(1), 45.
+ Open protocol
+ Expand
4

Quantitative Analysis of lncRNA PVT1

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from the cells or tissues using TRIzol reagent (Invitrogen). The purity of the extracted RNA was measured using a spectrophotometer (Unico). Next, the extracted RNA was subjected to reverse transcription to obtain cDNA using the PrimeScript RT‐PCR kit (TaKaRa). qRT‐PCR analysis was performed using SYBR™ Premix Ex Taq™ (TaKaRa) in the 7500 Fast Real‐Time System (Applied Biosystems). GAPDH was used as a loading control. The relative expression of lncRNA PVT1 was calculated by the 2−△△Ct method. The following primers were used for qRT‐PCR analysis: lncRNA PVT1 forward, 5ʹ‐CAGCACTCTGGACGGAC‐3ʹ; lncRNA PVT1 reverse, 5ʹ‐CAACAGGAGAAGCAAACA‐3ʹ. GAPDH forward, 5ʹ‐ACTAGGCGCT CACTGTTCTC‐3ʹ; GAPDH reverse, 5ʹ‐ATCCGTTGACTCCGACCTTC‐3ʹ.
Xun C., Jiang D., Tian Z., Yunus A, & Chen J. (2020). Long noncoding RNA plasmacytoma variant translocation gene 1 promotes epithelial‐mesenchymal transition in osteosarcoma. Journal of Clinical Laboratory Analysis, 35(1), e23587.
+ Open protocol
+ Expand
5

Osmotic Fragility of Blood Cells under NIV

Check if the same lab product or an alternative is used in the 5 most similar protocols
Osmotic fragility tests were performed on blood taken before and 30 min, 1 h, and 2 h after commencement of NIV. Fifty microliter of blood was washed three times with PBS and resuspended in different concentrations of phosphate-buffered saline of osmolarity ranging from 0–295 mOsm/kg. The mixtures were incubated at room temperature for 0.5 h and then centrifuged (3000 r/min). The absorbance of the supernatants was measured at 540 nm with a spectrophotometer (UNICO Instruments, Shanghai, China). The hemolysis rates were calculated.
Wang X.F., Ye M., Yan D., Zhang H.M., Jia P., Ren X.J, & Zeng Y.J. (2017). Non-invasive ventilation improves hemorheology status in hypoxemic patients with acute myocardial infarction after PCI. Journal of Geriatric Cardiology : JGC, 14(4), 274-279.
+ Open protocol
+ Expand
6

Antioxidant Capacity of Fig and Olive Extracts

Check if the same lab product or an alternative is used in the 5 most similar protocols
The ability of Ficus carica L and Olea europaea L extracts to scavenge
DPPH free radicals was estimated by the reduction of the color
reaction between DPPH solution and sample extracts. For this
purpose, we used the method described elsewhere [27 ]. Briefly, 2
mL of 0.12 mM solution DPPH in methanol was added to 1 mL of
various concentrations of each extract (50 - 1000 µg/mL) to be
tested. After 30 min at room temperature, the absorbance of the
reaction mixture was measured at 517 nm using a
spectrophotometer (UNICO, USA). Ascorbic acid (2- 20 µg/mL)
was used as positive controls. The scavenger activity was calculated
as follows:
I% = ((A Control-A Sample)/ A Control) * 100. Where A Control is
the absorbance of the blank sample (t = 0 min) and A Sample is the
absorbance of the test extract or standard (t = 30 min). The tests
were carried out in triplicate. The IC50 values (concentration in
µg/mL required to inhibit DPPH radical by 50%) were estimated
from the percentage inhibition versus concentration plot, using a
Regtox software. The data were presented as mean values ±
standard deviation (n = 3).
Ayoub L., Hassan F., Hamid S., Abdelhamid Z, & Souad A. (2019). Phytochemical screening, antioxidant activity and inhibitory potential of Ficus carica and Olea europaea leaves. Bioinformation, 15(3), 226-232.
+ Open protocol
+ Expand
7

MTT Assay for Cell Viability

Check if the same lab product or an alternative is used in the 5 most similar protocols
This site uses cookies to ensure you get a better browsing experience. Read our Privacy Policy. OK
Cell viabilities were measured on the basis of the conversion of 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-Htetrazolium bromide (MTT) into formazan by viable cells, which is termed the MTT method (20 20 He Q, Yuan LB. Dopamine inhibits proliferation, induces differentiation and apoptosis of K562 leukaemia cells. Chin Med J (Engl). 2007;120 (11):970-4. ) . Briefly, the cells were irradiated with 144 mJ/cm 2 UVB for 2 h and then cultured for 0, 6, 12, and 24 h after irradiation. These four time-point groups were named "I (2h) + C (0 h)," "I (2h) + C (6 h)," "I (2h) + C (12 h)," and "I (2h) + C (24 h)," respectively. Subsequently, 10% MTT (5 mg/mL) was added to the medium in a 35-mm Petri dish. The cells were incubated for 4 h at 37°C in the dark, and the medium was carefully aspirated with needle tubing. Then, formazan was dissolved with 2 mL of dimethyl sulfoxide. The dish was shaken slowly for 15 min. Finally, the optical density (490 nm) value was measured using a spectrophotometer (UNICO, Shanghai, China).
Du S., Li J., Chen L., Niu Z, & Gao L. (2021). Dynamic changes in and time sequence of ultraviolet B-induced apoptosis in rat corneal epithelial cells. Arquivos brasileiros de oftalmologia, 85(4).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!