To generate a base editing plasmid for eukaryotic cells, ABE8e was amplified via overlap-PCR by using the pABE8e-protein plasmid as template (Addgene plasmid # 161,788; Additional file 3 : Table S2, primers “ABE8e F,” “Linker mod R,” “Linker mod F,” and “ABE8e R”) and cloned into pLenti-mCherry plasmid with NotI and XbaI restriction enzymes. Additionally, we included a linker with the unique restriction site BspEI between TadA and SpCas9. TadA domains of clusters 2, 3030 and 3301 (primer “TadA F,” “TadA c2 R,” “TadA c3030 R,” and “TadA c3301 R”) were amplified via PCR using the respective pEVO plasmids as template and were cloned into pLenti-ABE8e-mCherry with NotI and BspEI restriction enzymes. The PCRs were performed with a high-fidelity polymerase (Herculase II Fusion DNA Polymerase, Agilent). In vitro transcribed (IVT) mRNA was prepared from a PCR amplicon carrying the gene of interest, which were generated with the primers ABE mRNA F and ABE mRNA R (Additional file 3 : Table S2) and Herculase II Fusion DNA Polymerase (Agilent, Santa Clara, CA, USA). IVT mRNAs were generated according to the manufacturer’s guidelines using the HiScribe T7 ARCA mRNA Kit (NEB, Ipswich, MA, USA) followed by purification using Monarch RNA Cleanup Kit (NEB, Ipswich, MA, USA).
Herculase 2 fusion dna polymerase
Manufactured by Agilent Technologies
Sourced in United States, Germany, Canada, Spain
Herculase II Fusion DNA Polymerase is a high-fidelity DNA polymerase designed for accurate PCR amplification. It features a proofreading domain that enhances the enzyme's fidelity, making it suitable for applications requiring precise DNA replication.
Automatically generated - may contain errors
Lab products found in correlation
Qiaquick pcr purification kit, by Qiagen (10 mentions)
Qiaquick gel extraction kit, by Qiagen (8 mentions)
Nextseq 500, by Illumina (5 mentions)
Ampure xp bead, by Beckman Coulter (5 mentions)
Dnase 1, by Thermo Fisher Scientific (5 mentions)
Superscript 3, by Thermo Fisher Scientific (4 mentions)
Dneasy blood tissue kit, by Qiagen (4 mentions)
Miseq platform, by Illumina (4 mentions)
Hiseq 2500, by Illumina (4 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (4 mentions)
Rneasy plus mini kit, by Qiagen (3 mentions)
3730xl dna analyzer, by Thermo Fisher Scientific (3 mentions)
P7 barcodes, by Illumina (3 mentions)
Herculase 2 fusion dna polymerase, by Illumina (3 mentions)
Kapa library quantification kit, by Roche (3 mentions)
Agencourt ampure xp kit, by Beckman Coulter (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Quickextract dna extraction kit, by Illumina (3 mentions)
Nextseq, by Illumina (3 mentions)
Hiscribe t7 arca mrna kit, by New England Biolabs (3 mentions)
191 protocols using herculase 2 fusion dna polymerase
1
Generation of Eukaryotic Base Editing Plasmid
2
Lentiviral Expression of Mutant FANCA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mutant FANCA expression plasmids were obtained by site-directed mutagenesis (QuikChange II XL Site-Directed Mutagenesis Kit, Agilent) from a wild-type open reading frame (ORF) construct (the primers used for generating FANCA mutations are listed in Table 2 ). Mutant and wild-type FANCA ORFs were then polymerase chain reaction (PCR)-amplified using high-fidelity Taq polymerase (Herculase II fusion DNA polymerases, Agilent) and primers that generated a FANCA ORF with a carboxy-terminal Flag tag. PCR fragments were cloned into pcr8/gw/topo entry vector (Invitrogen) and Gateway-cloned into a lentiviral expression vector (pHAGE_CMV_IP_HAFLAG; kindly provided by A. Smogorzewska) and Sanger sequence–verified. Each expression plasmid was transfected together with the packaging plasmids (SV40 Gag/Pol, SV40 VSVG, SV40 Rev, and SV40 Tat) described previously (Mostoslavsky et al. 2005 (link)). Supernatant containing lentiviral particles were collected, filtered, and placed on RA3087 cells with polybrene at a final concentration of 8 µg/ml. Following 24 h incubation, the media containing the virus is removed, and fresh complete media is added. Seventy-two hours after infection, the media is replaced with fresh media containing puromycin at 1 µg/ml. Following 7 d of puromycin selection, cells were collected to check for FANCA protein expression.
3
Quantification of Alternative Splicing and Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared from cells with RNeasy Plus Mini Kit (Qiagen, 74136) as per manufacturer’s instructions. The first strand cDNAs were synthesized from 1 g total RNA using Oligo(dT)20 primer or random hexamer and SuperScriptIII reverse transcriptase (Invitrogen, 18080-093) following the manufacture’s protocol. For alternative splicing quantification, 1/20 of cDNA was used as a template for the PCR amplification with Herculase II Fusion DNA Polymerases (Agilent Genomics, 600675) and the following primers: SERCA1_exon22 forward –5’- GCTCATGGTCCTCAAGATCTCAC and reverse – 5’ AGCTCTGCCTGAAGATGTGTCAC; INSR_exon11 forward -5’ CCAAAGACAGACTCTCAGAT and reverse 5’ AACATCGCCAAGGGACCTGC. PCR amplification was performed as follows: 95 °C for 1 min; followed by 30 cycles of 95 °C for 20 s, 55 °C for 20 s, 68 °C for 1 min and final extension at 68 °C for 4 min. The PCR products were analyzed by electrophoresis with 2.2% agarose gels and the density of bands was quantified using ImageJ. To quantify SERCA1, INSR, DMPK mRNA and 18S rRNA, quantitative PCR were performed per manufacturer’s instructions using TaqMan® Gene Expression Assay (ThermoFisher, Hs01092295, Hs00961557, Hs01094329 and Hs99999901).
4
Genomic DNA Extraction and Quantitative PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNAs were isolated from colonized cells using QIAamp blood DNA mini kit (Qiagen, 51104). 100 ng gDNA was used as a template for the PCR amplification with Herculase II Fusion DNA Polymerases (Agilent Genomics, 600675) and the following primers: FZ038, 5’-TCTGCCAGGAAATCAAGGAG; FZ042, 5’-ACGCCGTAGAACTTGGACTC; FZ043, 5’-ACACCGTGTACAAGGCCAAG; FZ041, 5’-TGGTGCCCACAAAAGCTAAC. PCR amplification was performed as follows: 95 °C for 2 min; 20 cycles of 95 °C for 20 s, 65∼55 °C (decrease 0.5 °C every cycle) for 20 s, 72 °C for 30 s; followed by 10 cycles of 98 °C for 20 s, 55 °C for 20 s, 72 °C for 30 s; and final extension at 72 °C for 3 min. The PCR products were analyzed by electrophoresis with 1.2% agarose gels.
Droplet Digital PCR was performed using 25 ng gDNA, primers (MBNL1-f: 5’-TGCATGCACAGTCATTTTTG, MBNL1-r: 5’-GCTTGGCACATTCATCTCTG, ZsGreen-f: 5’- ACACCGTGTACAAGGCCAAG and ZsGreen-r: 5’-GTCAGGTGCCACTTCTGGTT),
QX200 ddPCR EvaGreen Supermix (Bio-Rad, 1864033) and QX200 Droplet Digital PCR System (Bio-Rad, 1864001) were performed as per manufacturer’s instructions. Data was analyzed for relative gene copy numbers by QuantaSoft Software.
Droplet Digital PCR was performed using 25 ng gDNA, primers (MBNL1-f: 5’-TGCATGCACAGTCATTTTTG, MBNL1-r: 5’-GCTTGGCACATTCATCTCTG, ZsGreen-f: 5’- ACACCGTGTACAAGGCCAAG and ZsGreen-r: 5’-GTCAGGTGCCACTTCTGGTT),
QX200 ddPCR EvaGreen Supermix (Bio-Rad, 1864033) and QX200 Droplet Digital PCR System (Bio-Rad, 1864001) were performed as per manufacturer’s instructions. Data was analyzed for relative gene copy numbers by QuantaSoft Software.
5
Comprehensive Genomic Analysis of Fibroblasts and iPSCs
6
CRISPR-Mediated Knockout of ARID5A
7
Molecular Cloning of Wheat Mosaic Virus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HPWMoV-Nebraska isolate virion RNA, prepared from partially purified nucleocapsids (Tatineni et al., 2014a) , was used as a template for RT-PCR amplification of HPWMoV-encoded ORF 2a, 2b, 3A, and 4-8. The HPWMoV ORF-specific forward and reverse primers were synthesized based on GenBank sequence with accession numbers: KJ939624 (ORFs 2a and 2b), KJ939625 (ORF 3A), and KJ939627 to KJ939631 (ORFs 4-8). Tobacco etch virus-leader sequence (Carrington and Freed, 1990 ) was fused to the 5' end of each of HPWMoV ORF through overlap extension PCR (Ho et al., 1989) and ligated into pCASS4 between StuI and SacI restriction sites. pCASS-TriMV P1 and pPZP-dsGFP (35S-dsGFP), and pPZP-GFP (35S-GFP) were previously described in Tatineni et al. (2012) and Qu et al. (2003) , respectively. Frameshift mutants (-1) of P7 and P8 were generated by deleting one nucleotide in the first codon of each ORF, followed by ligation into pCASS4 between StuI and SacI restriction sites. All PCR reactions were performed with Herculase II Fusion DNA polymerase (Agilent Technologies, Santa Clara, CA). The presence of authentic sequence in plasmid DNAs was confirmed by nucleotide sequencing using Applied Biosystems 3730xl DNA Analyzer at the University of Florida ICBR Core DNA Sequencing Facility.
8
Genomic DNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from sorted cells were extracted using the QIAGEN DNeasy Blood & Tissue Kits following the manufacturer’s protocol, with the exception of DNA elution in water instead of buffer AE. sgRNA-insert was first PCR-amplified using Herculase II Fusion DNA polymerase (Agilent) with primers (Forward) AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG and (Reverse) CTTTAGTTTGTATGTCTGTTGCTATTATGTCTACTATTCTTTCC, using up to 2 μg genomic DNA per 50 μl reaction. Equal volumes from each reaction were pooled and used for a further PCR amplification step to attach Illumina sequencing adaptors and Illumina P7 barcodes, using Herculase II Fusion DNA polymerase. The 330 bp library was gel purified and quantified using KAPA library quantification kit (Roche). Libraries were pooled and sequenced with a HiSeq 4000 at the CRUK Cambridge NGS facility.
9
Quantifying mtDNA Damage via Long-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We estimated mtDNA damage using a quantitative ‘long’ PCR-based assay based on the principle that DNA damage slows down or block DNA polymerase advance41 . This assay has been previously validated in several species (see63 (link)). The levels of lesions were quantified by the amplification of large mitochondrial genomic fragment and normalized by a short mitochondrial fragment (COI gene), which is less likely to be affected by the random damage (see details of design and validation of primers and PCR conditions in Supplementary Methods and Table S5 ). qPCRs were performed in SureCycler 8800 thermal cycler (Agilent) using Herculase II fusion DNA polymerase (Agilent) and DNA was quantified using PicoGreen (dsDNA assay kit Invitrogen) in a Synergy HT BioTek microplate reader (see details in Supplementary Methods). Relative DNA lesion frequencies were normalized to reference as described by Furda et al.64 . Briefly, we estimated the relative damage per DNA strand as the ratio of fluorescence values of large and small mtDNA target in each sample (RS) and in the reference (RR). Normalized mtDNA damage was determined as –ln(RS/RR).
10
Amplicon library preparation for Illumina sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All PCR reactions were performed using Herculase II Fusion DNA Polymerase (Agilent) and total number of reactions were based on extracted gDNA yields. PCR1 reactions were prepared by mixing 20 µL Herculase 5× Buffer, 1 µL of 100 mM dNTP, 2.5 µL of Adapter Primer F, 2.5 µL of Adapter Primer R, 1 µL Herculase II Fusion Enzyme, 10 µg of the gDNA extracted and PCR grade water to a final 100 µL volume. PCR1 reactions were performed using a thermocycler (98 °C for 2 min, 98 °C for 10 s, 60 °C for 20 s, 72 °C for 30 s, and 72 °C for 2 min for 18 cycles). All PCR1 reactions were then pooled and kept at −20 °C. For PCR2, 8 reactions were performed for each sample in a total 100 µL volume (20 µL Herculase 5× Buffer, 1 µL of 100 mM dNTP, 2.5 µL of Adapter Primer F, 2.5 µL of Adapter Primer R, 1 µL Herculase II Fusion Enzyme, 5 µL of PCR1 amplicon and 68 µL of PCR grade water). PCR2 reactions were performed as described for PCR1. Final PCR products were run on a 2% gel and extracted and purified using the QIAquick PCR & Gel Cleanup Kit (Qiagen) and subjected to next generation sequencing by Quebec Genome Center. 80 cycle and 20 million reads for each sample were performed by Hiseq 2500.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!