Rnx plus
Manufactured by CinnaGen
Sourced in Iran, Islamic Republic of, United States
The RNX-Plus is a compact and versatile laboratory instrument designed for the extraction and purification of RNA from a variety of sample types. It utilizes a patented technology to ensure efficient and reliable RNA isolation, making it a valuable tool for researchers and scientists working in the field of molecular biology, genomics, and related disciplines.
Automatically generated - may contain errors
Lab products found in correlation
Dnase 1, by Thermo Fisher Scientific (7 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (6 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (6 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Trypsin, by Merck Group (2 mentions)
Taq dna polymerase, by Roche (2 mentions)
Epoch microplate spectrophotometer, by Agilent Technologies (2 mentions)
Realq plus 2x master mix green with high roxtm, by Ampliqon (2 mentions)
Rotor gene 6000 cycler, by Qiagen (2 mentions)
Sybr premix ex taq 2, by Takara Bio (2 mentions)
Biophotometer, by Eppendorf (2 mentions)
Quantitect reverse transcription kit, by Qiagen (2 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Sybr premix ex taq kit, by Takara Bio (1 mentions)
Cdna synthesis kit, by Yekta Tajhiz Azma (1 mentions)
Oligo dt primer, by Thermo Fisher Scientific (1 mentions)
Uv spectrophotometer, by Eppendorf (1 mentions)
Agarose, by Merck Group (1 mentions)
33 protocols using rnx plus
1
Total RNA Extraction from Diverse Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
Extraction Buffer 1 : 200 mM Tris–HCl (pH 8), 1.4 M NaCl, 25 mM EDTA, 3% (w/v) CTAB, Add β-mercaptoethanol to a final concentration of 2% (v/v) just before use.
Extraction Buffer 2 : RNX-Plus (Cinnagen, RNX-Plus is a Guanidine/phenol solution for total RNA isolation from homogenized sample).
Extraction Buffer 3 : Buffer RLT and Buffer RLC (RNeasy Plant Mini Kit, Qiagen).
+ Expand
2
Quantitative Analysis of Apoptosis Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extraction process of total RNA was done from cell samples using RNX-PlusTM (Cinnagen, Tehran, Iran). The concentration of RNA was evaluated by a Nanodrop spectrophotometer (Varian, Australia) at 260/280 nm wavelength. Then, cDNA was synthesized by the cDNA Synthesis kit (Yekta Tajhiz Azma, Tehran, Iran). Using qRT-PCR, the expression level of anti-apoptotic and pro-apoptotic genes was determined in DU-145 transfected and non-transfected cells by SYBR Premix Ex Taq™ kit (Takara Bio, Japan). The characteristics of the genes used are demonstrated in Table 1 . GAPDH gene was selected as endogenous control. The cycling conditions inclusive: initial denaturation at 95 °C for 5 min, 30 cycles for denaturation at 94 °C for 40 s, annealing at 64 °C for 40 s, and extension at 72 °C for 40 s, followed by 72 °C for 5 min for duplication of unfinished fragments. Analysis of gene expression was performed using (2-ΔΔCt) method.
3
Quantitative Analysis of Apoptosis Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted with RNX-Plus (Cinnagen, Iran), and any genomic contamination was checked using DNase 1 (Fermentas, Vilnius, and Lithuania). First-strand complementary DNA (cDNA) was synthesized from isolated RNA using superscript II and reverse transcribed by oligo (dt) primers (Fermentas, Vilnius, and Lithuania). The expression of b-cell lymphoma protein 2 (Bcl-2) and Bcl-2-associated X protein (BAX) genes were examined by quantitative real-time PCR using specific primers prepared by the Bioneer Corporation under the PCR condition as described previously. Table I shows the characteristics of the primers. Beta-actin was used as an internal reference gene, and PCR analysis was carried out using a 2 method, as explained before (13).
4
Stem Cell Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from SSCs derived from all groups, using an RNX-Plus TM (Cinnagen,
Iran). RNA concentrations were evaluated by a UV spectrophotometer (Eppendorf, Germany).
RevertAidTM first-strand cDNA synthesis kit (Fermentase) with oligo dT primer was used for
reverse-transcription of treated RNA. Oligonucleotide PCR primers specific for
alpha-6-integrin, beta-1 integrin, PLZF, C-MYC, NANOG, OCT-4, and
TBP (internal control) genes were adapted from other primers and
synthesized by GenFanAvaran Company.
The Thermal Cycler used SYBR Green and PCR master
mix (Cinnagen) for PCR reactions (Applied Biosystems,
StepOne TM, USA). Cycling conditions were initiated
with a melting period at 95°C for 5 minutes, chased by
40 cycles of melting 30 seconds at 95°C, annealing 30
seconds at 58-60°C and extending 30 seconds at 72°C.
Melt curve analysis was performed, and the standard
curve for each gene was prepared using serial cDNA
dilution from the testis to determine the output. The same
run amplified the target gene and the reference gene.
The ratio of gene expression was determined using the
comparative cycle threshold (CT) method (n=3).
Iran). RNA concentrations were evaluated by a UV spectrophotometer (Eppendorf, Germany).
RevertAidTM first-strand cDNA synthesis kit (Fermentase) with oligo dT primer was used for
reverse-transcription of treated RNA. Oligonucleotide PCR primers specific for
alpha-6-integrin, beta-1 integrin, PLZF, C-MYC, NANOG, OCT-4, and
TBP (internal control) genes were adapted from other primers and
synthesized by GenFanAvaran Company.
The Thermal Cycler used SYBR Green and PCR master
mix (Cinnagen) for PCR reactions (Applied Biosystems,
StepOne TM, USA). Cycling conditions were initiated
with a melting period at 95°C for 5 minutes, chased by
40 cycles of melting 30 seconds at 95°C, annealing 30
seconds at 58-60°C and extending 30 seconds at 72°C.
Melt curve analysis was performed, and the standard
curve for each gene was prepared using serial cDNA
dilution from the testis to determine the output. The same
run amplified the target gene and the reference gene.
The ratio of gene expression was determined using the
comparative cycle threshold (CT) method (n=3).
5
Quantification of Bach1 Expression in MDA-MB-468 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following reagents were used: RPMI-1640 medium containing l-glutamine, the antibiotics: penicillin/ streptomycin, fetal bovine serum (FBS), dimethyl sulfoxide (DMSO), trypsin/ethylenediaminetetraacetic acid (EDTA), agarose (Sigma-Aldrich, St. Louis, MO, USA); cell MDA-MB-468 (Pasteur Institute of Iran); sodium bicarbonate, trypan blue dye, 96-, 24-, and 6-well cell culture plates and cell culture flasks, and CryoTube (Merck KGaA, Darmstadt, Germany); gene-specific bach1, transfection reagents for siRNA, the transfected siRNA (Santa Cruz Biotechnology, CA, USA); RNX PLUS and diethyl pyrocarbonate (DEPC); DNA Ladder 100 bp (CinnaGen, Iran); polymerase chain reaction (PCR), buffer, deoxynucleotide triphosphate (dNTP), MgCl 2 (Fermentas, Helsinki, Finland); Moloney murine leukemia virus (MMLV) reverse transcriptase (Thermo Fisher Scientific, WI, USA); Taq DNA polymerase (Roche Molecular Biochemical, Mannheim, Germany); specific primers (TAKAPOU ZIST, Tehran, Iran); DNA green view (GeneCopoeia, Rockville, MD, USA); SYBR Premix Ex Taq (TAKARA BIO, Otsu, Japan); and miRCURY LNA™ Universal RT miRNA PCR kit and miRCURY™ RNA Isolation kits were purchased from Exiqon (Vedbaek, Denmark).
6
Extraction and RT-qPCR Analysis of Kidney RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of the lower part of the left kidney was extracted using RNX-plus (CinnaGen, Tehran, Iran) according to the manufacturer's instruction. Afterward, the concentration of the extracted RNA was measured by Epoch microplate spectrophotometer (BioTek, Winooski, Vermont). Since ORs sequence contains only the exon coding region, to eliminate DNA contamination, the samples were treated with DNase I (Thermo Fisher, Waltham, Massachusetts). To validate this procedure, mock controls were also employed.
Subsequently, random hexamer primered cDNA synthesis was done using the first-strand cDNA synthesis kit (YektaTajhiz, Tehran, Iran). Specific primers for the selected ORs, Hprt and Tfrc were designed using AlleleID software version 6.2 (Supplementary Table 1) (Apte & Singh, 2007) (link). Real-time quantitative polymerase chain reaction (RT-qPCR) was performed using RealQ Plus 2x Master Mix Green with high ROX TM (Ampliqon, Odense, Denmark) by Rotor-gene 6000 cycler (Qiagen, Hilden, Germany). The expression of genes was normalized by considering Hprt and Tfrc as internal control genes. The results of RT-qPCR were analyzed using the relative expression software tool (REST) version 1 (Pfaffl, Horgan, & Dempfle, 2002) (link).
Subsequently, random hexamer primered cDNA synthesis was done using the first-strand cDNA synthesis kit (YektaTajhiz, Tehran, Iran). Specific primers for the selected ORs, Hprt and Tfrc were designed using AlleleID software version 6.2 (Supplementary Table 1) (Apte & Singh, 2007) (link). Real-time quantitative polymerase chain reaction (RT-qPCR) was performed using RealQ Plus 2x Master Mix Green with high ROX TM (Ampliqon, Odense, Denmark) by Rotor-gene 6000 cycler (Qiagen, Hilden, Germany). The expression of genes was normalized by considering Hprt and Tfrc as internal control genes. The results of RT-qPCR were analyzed using the relative expression software tool (REST) version 1 (Pfaffl, Horgan, & Dempfle, 2002) (link).
7
Quantifying Multinucleation Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using RNX-plus (CinnaGen, Iran) according to the manufacturer’s instruction. To eliminate DNA contamination, the samples were treated with DNase I (Thermo Fisher, Massachusetts). To validate this procedure, mock controls were also employed. Subsequently, random hexamer-primed cDNA synthesis was performed using the first-strand cDNA synthesis kit (YektaTajhiz, Iran). Genes related to multinucleation were selected from the literature, and specific primers were designed (Additional file 2 : Table S2). Quantitative PCR was performed using RealQ Plus 2 × Master Mix Green with high ROXTM (Ampliqon, Denmark) by StepOne machine (ABI, USA). The expression of the genes was normalized by considering Hprt and Tfrc as reference genes. The results were analyzed using the ΔΔCt method.
8
RT-qPCR Analysis of COVID-19 Related Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by RNX-Plus (CinnaGen, Iran). After assessment of RNA quantity and quality respectively evaluated by NanoDrop 2000 (Thermo Fisher Scientific, USA) and gel electrophoresis, cDNAs were synthesized by first strand cDNA synthesis kit (Thermo Scientific, USA) according to manufacturers’ instructions. RT-qPCR was performed by Rotor-Gene Q MDX (QIAGEN Hilden, Germany). The expression level of ACE, AGTR1, ACE2 and TMPRSS2 transcripts were determined using SYBR Premix Ex Taq II (Takara, China) and specific primers which were presented in Table 1 . All experiments were performed in duplicate. The relative mRNA levels in studied genes expression were normalized to Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression, as internal control [21 ].Table 1
The sequence of forward and reverse primers.
| Primers | Sequence 5′→3 | Reference |
|---|---|---|
| GAPDH Forward | GAGGGCCATCCACAGTCTTCTG | [21 ] |
| GAPDH Reverse | CCCTTCATTGACCTCAACTACATGGT | |
| ACE Forward | GGAGGAATATGACCGGACATCC | [27 (link)] |
| ACE Reverse | TGGTTGGCTATTTGCATGTTCTT | |
| ACE2 Forward | AACCCAGATAATCCACAAGAATGC | The current study |
| ACE2 Reverse | TCATAGTCTCCTCTCCAATAATCCC | |
| AGTR1 Forward | ATTTAGCACTGGCTGACTTATGC | [28 (link)] |
| AGTR1 Reverse | CAGCGGTATTCCATAGCTGTG | |
| TMPRSS2 Forward | TCATCCTTCAGGTGTACTCATCTC | The current study |
| TMPRSS2 Reverse | TCCGCTGTCATCCACTATTCC |
9
Comprehensive Cell Culture Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell culture products, MTT Kit, and propidium iodide were purchased from Sigma-Aldrich. (St. Louis, Mo, USA), Design and construction of siRNA, transfection reagent, transfection media and primary antibody were purchased from Santacruz biotechnology. (California, USA), SYBR Premix Ex Taq was purchased from Takara BIO. (Otsu, Shiga, Japan), Protease inhibitor cocktail, ECL Kit, PVDF membrane, In Situ Cell Death Detection Kit and Taq DNA polymerase were purchased from Roche Diagnostics (Gmb.H, Germany), MMLV reverse transcriptase was purchased from Thermo scientific (WI, USA), RNX-PLUS, primer, and DEPC were purchased from Cinnagen (Tehran, Iran), dNTP and buffer PCR were purchased from Fermentas (Helsinki, Finland), RNase. A was purchased from Bioneer. (Daedeok-gu, Daejeon, Korea), horseradish peroxidase-conjugated rabbit anti-goat was purchased from Cyto Matin Gene Company (Isfahan, Iran).
10
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA extraction was performed by using RNX Plus (Cinnagen, Iran) according to the manufacturer’s instruction under RNAase free condition. The concentration and purity of the extracted RNA was detected (A260/A280) by Biophotometer (Eppendorf, Germany) and its quality was approved by electrophoresis. cDNA was synthesized by RevertaidTM first strand cDNA synthesis (Fermentas, USA) according to the manufacturer’s instruction in order to detect the mRNAs of HLA-G and β- Globin, and were stored at -20°C.
+ Expand
RNA extraction was performed by using RNX Plus (Cinnagen, Iran) according to the manufacturer’s instruction under RNAase free condition. The concentration and purity of the extracted RNA was detected (A260/A280) by Biophotometer (Eppendorf, Germany) and its quality was approved by electrophoresis. cDNA was synthesized by RevertaidTM first strand cDNA synthesis (Fermentas, USA) according to the manufacturer’s instruction in order to detect the mRNAs of HLA-G and β- Globin, and were stored at -20°C.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!